ID: 1022109130

View in Genome Browser
Species Human (GRCh38)
Location 7:27217285-27217307
Sequence GTGTGTGTGGGGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022109121_1022109130 17 Left 1022109121 7:27217245-27217267 CCTAATCTTTAGACACACTGAAT No data
Right 1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG No data
1022109123_1022109130 -6 Left 1022109123 7:27217268-27217290 CCAGGATAAGTGTGTGTGTGTGT No data
Right 1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022109130 Original CRISPR GTGTGTGTGGGGAAGGTGGT GGG Intergenic
No off target data available for this crispr