ID: 1022112245

View in Genome Browser
Species Human (GRCh38)
Location 7:27239045-27239067
Sequence CACTGCTGGGTGCACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112245_1022112252 -4 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112252 7:27239064-27239086 AGTGGCACTAGGTTCCCAAAAGG No data
1022112245_1022112256 15 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112256 7:27239083-27239105 AAGGGCATCAGCAGCTGCCAAGG No data
1022112245_1022112260 25 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112260 7:27239093-27239115 GCAGCTGCCAAGGCAGAAGGGGG No data
1022112245_1022112259 24 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112259 7:27239092-27239114 AGCAGCTGCCAAGGCAGAAGGGG No data
1022112245_1022112257 22 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112245_1022112253 -3 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data
1022112245_1022112258 23 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112245 Original CRISPR CACTGCTGGGTGCACCCCTG GGG (reversed) Intergenic
No off target data available for this crispr