ID: 1022112251

View in Genome Browser
Species Human (GRCh38)
Location 7:27239059-27239081
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112251_1022112263 18 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112263 7:27239100-27239122 CCAAGGCAGAAGGGGGAAGCGGG No data
1022112251_1022112259 10 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112259 7:27239092-27239114 AGCAGCTGCCAAGGCAGAAGGGG No data
1022112251_1022112257 8 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112251_1022112258 9 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112251_1022112256 1 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112256 7:27239083-27239105 AAGGGCATCAGCAGCTGCCAAGG No data
1022112251_1022112261 17 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112251_1022112260 11 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112260 7:27239093-27239115 GCAGCTGCCAAGGCAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112251 Original CRISPR TGGGAACCTAGTGCCACTGC TGG (reversed) Intergenic
No off target data available for this crispr