ID: 1022112253

View in Genome Browser
Species Human (GRCh38)
Location 7:27239065-27239087
Sequence GTGGCACTAGGTTCCCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112246_1022112253 -4 Left 1022112246 7:27239046-27239068 CCCAGGGGTGCACCCAGCAGTGG No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data
1022112241_1022112253 12 Left 1022112241 7:27239030-27239052 CCACTCGACCTTATTCCCCAGGG No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data
1022112244_1022112253 4 Left 1022112244 7:27239038-27239060 CCTTATTCCCCAGGGGTGCACCC No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data
1022112239_1022112253 28 Left 1022112239 7:27239014-27239036 CCTGCAAGTGTGAGATCCACTCG No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data
1022112248_1022112253 -5 Left 1022112248 7:27239047-27239069 CCAGGGGTGCACCCAGCAGTGGC No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data
1022112245_1022112253 -3 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112253 7:27239065-27239087 GTGGCACTAGGTTCCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112253 Original CRISPR GTGGCACTAGGTTCCCAAAA GGG Intergenic
No off target data available for this crispr