ID: 1022112254

View in Genome Browser
Species Human (GRCh38)
Location 7:27239078-27239100
Sequence GCAGCTGCTGATGCCCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112254_1022112261 -2 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112254_1022112263 -1 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112263 7:27239100-27239122 CCAAGGCAGAAGGGGGAAGCGGG No data
1022112254_1022112260 -8 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112260 7:27239093-27239115 GCAGCTGCCAAGGCAGAAGGGGG No data
1022112254_1022112259 -9 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112259 7:27239092-27239114 AGCAGCTGCCAAGGCAGAAGGGG No data
1022112254_1022112258 -10 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112254_1022112264 21 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112264 7:27239122-27239144 GTCCCAGAACCACCCACCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112254 Original CRISPR GCAGCTGCTGATGCCCTTTT GGG (reversed) Intergenic
No off target data available for this crispr