ID: 1022112257

View in Genome Browser
Species Human (GRCh38)
Location 7:27239090-27239112
Sequence TCAGCAGCTGCCAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112250_1022112257 9 Left 1022112250 7:27239058-27239080 CCCAGCAGTGGCACTAGGTTCCC No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112251_1022112257 8 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112244_1022112257 29 Left 1022112244 7:27239038-27239060 CCTTATTCCCCAGGGGTGCACCC No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112245_1022112257 22 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112246_1022112257 21 Left 1022112246 7:27239046-27239068 CCCAGGGGTGCACCCAGCAGTGG No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data
1022112248_1022112257 20 Left 1022112248 7:27239047-27239069 CCAGGGGTGCACCCAGCAGTGGC No data
Right 1022112257 7:27239090-27239112 TCAGCAGCTGCCAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112257 Original CRISPR TCAGCAGCTGCCAAGGCAGA AGG Intergenic
No off target data available for this crispr