ID: 1022112258

View in Genome Browser
Species Human (GRCh38)
Location 7:27239091-27239113
Sequence CAGCAGCTGCCAAGGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112248_1022112258 21 Left 1022112248 7:27239047-27239069 CCAGGGGTGCACCCAGCAGTGGC No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112251_1022112258 9 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112244_1022112258 30 Left 1022112244 7:27239038-27239060 CCTTATTCCCCAGGGGTGCACCC No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112250_1022112258 10 Left 1022112250 7:27239058-27239080 CCCAGCAGTGGCACTAGGTTCCC No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112246_1022112258 22 Left 1022112246 7:27239046-27239068 CCCAGGGGTGCACCCAGCAGTGG No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112254_1022112258 -10 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data
1022112245_1022112258 23 Left 1022112245 7:27239045-27239067 CCCCAGGGGTGCACCCAGCAGTG No data
Right 1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112258 Original CRISPR CAGCAGCTGCCAAGGCAGAA GGG Intergenic
No off target data available for this crispr