ID: 1022112261

View in Genome Browser
Species Human (GRCh38)
Location 7:27239099-27239121
Sequence GCCAAGGCAGAAGGGGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022112254_1022112261 -2 Left 1022112254 7:27239078-27239100 CCCAAAAGGGCATCAGCAGCTGC No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112250_1022112261 18 Left 1022112250 7:27239058-27239080 CCCAGCAGTGGCACTAGGTTCCC No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112255_1022112261 -3 Left 1022112255 7:27239079-27239101 CCAAAAGGGCATCAGCAGCTGCC No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112251_1022112261 17 Left 1022112251 7:27239059-27239081 CCAGCAGTGGCACTAGGTTCCCA No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112248_1022112261 29 Left 1022112248 7:27239047-27239069 CCAGGGGTGCACCCAGCAGTGGC No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data
1022112246_1022112261 30 Left 1022112246 7:27239046-27239068 CCCAGGGGTGCACCCAGCAGTGG No data
Right 1022112261 7:27239099-27239121 GCCAAGGCAGAAGGGGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022112261 Original CRISPR GCCAAGGCAGAAGGGGGAAG CGG Intergenic
No off target data available for this crispr