ID: 1022113038

View in Genome Browser
Species Human (GRCh38)
Location 7:27243135-27243157
Sequence GCCGGAGCCGCCCGAGAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022113035_1022113038 -7 Left 1022113035 7:27243119-27243141 CCGTGGGCAGCCCGCTGCCGGAG 0: 1
1: 0
2: 1
3: 29
4: 156
Right 1022113038 7:27243135-27243157 GCCGGAGCCGCCCGAGAAAATGG 0: 1
1: 0
2: 2
3: 5
4: 138
1022113033_1022113038 -1 Left 1022113033 7:27243113-27243135 CCGAAGCCGTGGGCAGCCCGCTG 0: 1
1: 0
2: 0
3: 15
4: 97
Right 1022113038 7:27243135-27243157 GCCGGAGCCGCCCGAGAAAATGG 0: 1
1: 0
2: 2
3: 5
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022113038 Original CRISPR GCCGGAGCCGCCCGAGAAAA TGG Exonic