ID: 1022113038 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:27243135-27243157 |
| Sequence | GCCGGAGCCGCCCGAGAAAA TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 146 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 5, 4: 138} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022113035_1022113038 | -7 | Left | 1022113035 | 7:27243119-27243141 | CCGTGGGCAGCCCGCTGCCGGAG | 0: 1 1: 0 2: 1 3: 29 4: 156 |
||
| Right | 1022113038 | 7:27243135-27243157 | GCCGGAGCCGCCCGAGAAAATGG | 0: 1 1: 0 2: 2 3: 5 4: 138 |
||||
| 1022113033_1022113038 | -1 | Left | 1022113033 | 7:27243113-27243135 | CCGAAGCCGTGGGCAGCCCGCTG | 0: 1 1: 0 2: 0 3: 15 4: 97 |
||
| Right | 1022113038 | 7:27243135-27243157 | GCCGGAGCCGCCCGAGAAAATGG | 0: 1 1: 0 2: 2 3: 5 4: 138 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022113038 | Original CRISPR | GCCGGAGCCGCCCGAGAAAA TGG | Exonic | ||