ID: 1022122410

View in Genome Browser
Species Human (GRCh38)
Location 7:27322067-27322089
Sequence AAACCCTCCTTCAGAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022122401_1022122410 20 Left 1022122401 7:27322024-27322046 CCAATACGTACTTCCTGGTATGG No data
Right 1022122410 7:27322067-27322089 AAACCCTCCTTCAGAAGGAAAGG No data
1022122405_1022122410 7 Left 1022122405 7:27322037-27322059 CCTGGTATGGCAGGCTGGCGCTC No data
Right 1022122410 7:27322067-27322089 AAACCCTCCTTCAGAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022122410 Original CRISPR AAACCCTCCTTCAGAAGGAA AGG Intergenic
No off target data available for this crispr