ID: 1022127558

View in Genome Browser
Species Human (GRCh38)
Location 7:27372893-27372915
Sequence CATCATTAGCAGTTATGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022127555_1022127558 28 Left 1022127555 7:27372842-27372864 CCTCTTTTACACACACACACACA 0: 9
1: 72
2: 652
3: 3045
4: 12349
Right 1022127558 7:27372893-27372915 CATCATTAGCAGTTATGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022127558 Original CRISPR CATCATTAGCAGTTATGGTT GGG Intergenic
No off target data available for this crispr