ID: 1022127887

View in Genome Browser
Species Human (GRCh38)
Location 7:27375593-27375615
Sequence GACACTAGGAGGGCTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022127887_1022127895 7 Left 1022127887 7:27375593-27375615 CCCCACAGAGCCCTCCTAGTGTC No data
Right 1022127895 7:27375623-27375645 TGCTCATTCTGCTGAATGGCTGG No data
1022127887_1022127893 3 Left 1022127887 7:27375593-27375615 CCCCACAGAGCCCTCCTAGTGTC No data
Right 1022127893 7:27375619-27375641 TCCTTGCTCATTCTGCTGAATGG No data
1022127887_1022127896 25 Left 1022127887 7:27375593-27375615 CCCCACAGAGCCCTCCTAGTGTC No data
Right 1022127896 7:27375641-27375663 GCTGGCTTCCATCCTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022127887 Original CRISPR GACACTAGGAGGGCTCTGTG GGG (reversed) Intergenic
No off target data available for this crispr