ID: 1022130192

View in Genome Browser
Species Human (GRCh38)
Location 7:27397757-27397779
Sequence TTGGTTCAGCAGACGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022130192_1022130197 11 Left 1022130192 7:27397757-27397779 CCCACCTCCGTCTGCTGAACCAA No data
Right 1022130197 7:27397791-27397813 ACTCTTCTCATCATGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022130192 Original CRISPR TTGGTTCAGCAGACGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr