ID: 1022131058

View in Genome Browser
Species Human (GRCh38)
Location 7:27405027-27405049
Sequence ATGGAGAACCAAAAATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022131053_1022131058 4 Left 1022131053 7:27405000-27405022 CCAAACAAGCCATGGTCCAATCT No data
Right 1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG No data
1022131052_1022131058 5 Left 1022131052 7:27404999-27405021 CCCAAACAAGCCATGGTCCAATC No data
Right 1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG No data
1022131055_1022131058 -5 Left 1022131055 7:27405009-27405031 CCATGGTCCAATCTCAAAATGGA No data
Right 1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG No data
1022131049_1022131058 30 Left 1022131049 7:27404974-27404996 CCTAGAACTAGCTGGTGTTCCTC No data
Right 1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG No data
1022131051_1022131058 11 Left 1022131051 7:27404993-27405015 CCTCTTCCCAAACAAGCCATGGT No data
Right 1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022131058 Original CRISPR ATGGAGAACCAAAAATAGGA AGG Intergenic
No off target data available for this crispr