ID: 1022132030

View in Genome Browser
Species Human (GRCh38)
Location 7:27413627-27413649
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022132030_1022132033 3 Left 1022132030 7:27413627-27413649 CCGCAGCCCTGAGCTAAGAGCAC No data
Right 1022132033 7:27413653-27413675 ACTTCTTTCTAAATGTGTGTTGG No data
1022132030_1022132036 29 Left 1022132030 7:27413627-27413649 CCGCAGCCCTGAGCTAAGAGCAC No data
Right 1022132036 7:27413679-27413701 CCTTGGCTGTCATCTATTAAAGG No data
1022132030_1022132034 12 Left 1022132030 7:27413627-27413649 CCGCAGCCCTGAGCTAAGAGCAC No data
Right 1022132034 7:27413662-27413684 TAAATGTGTGTTGGACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022132030 Original CRISPR GTGCTCTTAGCTCAGGGCTG CGG (reversed) Intergenic
No off target data available for this crispr