ID: 1022132031

View in Genome Browser
Species Human (GRCh38)
Location 7:27413633-27413655
Sequence AGTTATGTGCTCTTAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022132031_1022132033 -3 Left 1022132031 7:27413633-27413655 CCCTGAGCTAAGAGCACATAACT No data
Right 1022132033 7:27413653-27413675 ACTTCTTTCTAAATGTGTGTTGG No data
1022132031_1022132034 6 Left 1022132031 7:27413633-27413655 CCCTGAGCTAAGAGCACATAACT No data
Right 1022132034 7:27413662-27413684 TAAATGTGTGTTGGACTCCTTGG No data
1022132031_1022132036 23 Left 1022132031 7:27413633-27413655 CCCTGAGCTAAGAGCACATAACT No data
Right 1022132036 7:27413679-27413701 CCTTGGCTGTCATCTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022132031 Original CRISPR AGTTATGTGCTCTTAGCTCA GGG (reversed) Intergenic