ID: 1022132033

View in Genome Browser
Species Human (GRCh38)
Location 7:27413653-27413675
Sequence ACTTCTTTCTAAATGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022132030_1022132033 3 Left 1022132030 7:27413627-27413649 CCGCAGCCCTGAGCTAAGAGCAC No data
Right 1022132033 7:27413653-27413675 ACTTCTTTCTAAATGTGTGTTGG No data
1022132032_1022132033 -4 Left 1022132032 7:27413634-27413656 CCTGAGCTAAGAGCACATAACTT No data
Right 1022132033 7:27413653-27413675 ACTTCTTTCTAAATGTGTGTTGG No data
1022132031_1022132033 -3 Left 1022132031 7:27413633-27413655 CCCTGAGCTAAGAGCACATAACT No data
Right 1022132033 7:27413653-27413675 ACTTCTTTCTAAATGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022132033 Original CRISPR ACTTCTTTCTAAATGTGTGT TGG Intergenic
No off target data available for this crispr