ID: 1022132036

View in Genome Browser
Species Human (GRCh38)
Location 7:27413679-27413701
Sequence CCTTGGCTGTCATCTATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022132030_1022132036 29 Left 1022132030 7:27413627-27413649 CCGCAGCCCTGAGCTAAGAGCAC No data
Right 1022132036 7:27413679-27413701 CCTTGGCTGTCATCTATTAAAGG No data
1022132032_1022132036 22 Left 1022132032 7:27413634-27413656 CCTGAGCTAAGAGCACATAACTT No data
Right 1022132036 7:27413679-27413701 CCTTGGCTGTCATCTATTAAAGG No data
1022132031_1022132036 23 Left 1022132031 7:27413633-27413655 CCCTGAGCTAAGAGCACATAACT No data
Right 1022132036 7:27413679-27413701 CCTTGGCTGTCATCTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022132036 Original CRISPR CCTTGGCTGTCATCTATTAA AGG Intergenic
No off target data available for this crispr