ID: 1022132760

View in Genome Browser
Species Human (GRCh38)
Location 7:27419083-27419105
Sequence GAGGGCTTGCTTACGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022132760_1022132766 15 Left 1022132760 7:27419083-27419105 CCAGGAGCCGTAAGCAAGCCCTC No data
Right 1022132766 7:27419121-27419143 TGCCTTCAATGTGGACTTCAAGG No data
1022132760_1022132769 23 Left 1022132760 7:27419083-27419105 CCAGGAGCCGTAAGCAAGCCCTC No data
Right 1022132769 7:27419129-27419151 ATGTGGACTTCAAGGTCTGTGGG No data
1022132760_1022132768 22 Left 1022132760 7:27419083-27419105 CCAGGAGCCGTAAGCAAGCCCTC No data
Right 1022132768 7:27419128-27419150 AATGTGGACTTCAAGGTCTGTGG No data
1022132760_1022132765 6 Left 1022132760 7:27419083-27419105 CCAGGAGCCGTAAGCAAGCCCTC No data
Right 1022132765 7:27419112-27419134 CACTCAATCTGCCTTCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022132760 Original CRISPR GAGGGCTTGCTTACGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr