ID: 1022136903

View in Genome Browser
Species Human (GRCh38)
Location 7:27457543-27457565
Sequence TTCCTATTTAGAGGGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022136903_1022136910 23 Left 1022136903 7:27457543-27457565 CCAGGACTCCCTCTAAATAGGAA No data
Right 1022136910 7:27457589-27457611 TTATCCTAGTTGTGAAAACAAGG 0: 3
1: 0
2: 1
3: 15
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022136903 Original CRISPR TTCCTATTTAGAGGGAGTCC TGG (reversed) Intergenic
No off target data available for this crispr