ID: 1022142990

View in Genome Browser
Species Human (GRCh38)
Location 7:27509332-27509354
Sequence GGCTTTGACATGGTCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022142990_1022142993 6 Left 1022142990 7:27509332-27509354 CCATCATGGACCATGTCAAAGCC No data
Right 1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG No data
1022142990_1022142995 22 Left 1022142990 7:27509332-27509354 CCATCATGGACCATGTCAAAGCC No data
Right 1022142995 7:27509377-27509399 CATGAGGAAGCTCTGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022142990 Original CRISPR GGCTTTGACATGGTCCATGA TGG (reversed) Intergenic
No off target data available for this crispr