ID: 1022142991

View in Genome Browser
Species Human (GRCh38)
Location 7:27509342-27509364
Sequence ACACAACTTAGGCTTTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022142991_1022142997 23 Left 1022142991 7:27509342-27509364 CCATGTCAAAGCCTAAGTTGTGT No data
Right 1022142997 7:27509388-27509410 TCTGAAATGTGGTCCGTGAAGGG No data
1022142991_1022142998 26 Left 1022142991 7:27509342-27509364 CCATGTCAAAGCCTAAGTTGTGT No data
Right 1022142998 7:27509391-27509413 GAAATGTGGTCCGTGAAGGGAGG No data
1022142991_1022142996 22 Left 1022142991 7:27509342-27509364 CCATGTCAAAGCCTAAGTTGTGT No data
Right 1022142996 7:27509387-27509409 CTCTGAAATGTGGTCCGTGAAGG No data
1022142991_1022142993 -4 Left 1022142991 7:27509342-27509364 CCATGTCAAAGCCTAAGTTGTGT No data
Right 1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG No data
1022142991_1022142995 12 Left 1022142991 7:27509342-27509364 CCATGTCAAAGCCTAAGTTGTGT No data
Right 1022142995 7:27509377-27509399 CATGAGGAAGCTCTGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022142991 Original CRISPR ACACAACTTAGGCTTTGACA TGG (reversed) Intergenic
No off target data available for this crispr