ID: 1022145656

View in Genome Browser
Species Human (GRCh38)
Location 7:27537312-27537334
Sequence ATAGTTAAACATCTGAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022145654_1022145656 20 Left 1022145654 7:27537269-27537291 CCTCTTTTATCTCAATTACAACA 0: 1
1: 1
2: 4
3: 26
4: 295
Right 1022145656 7:27537312-27537334 ATAGTTAAACATCTGAGACAAGG 0: 1
1: 0
2: 1
3: 15
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022145656 Original CRISPR ATAGTTAAACATCTGAGACA AGG Intronic
901977365 1:13005731-13005753 TTATTTAAAAATTTGAGACAGGG + Intronic
902023940 1:13368938-13368960 TTATTTAAAAATTTGAGACAGGG - Intergenic
904279808 1:29411018-29411040 AATGTAAAGCATCTGAGACAGGG - Intergenic
905943471 1:41882919-41882941 ATTTTTAAAAATATGAGACAGGG + Intronic
906451256 1:45950162-45950184 ATAGGTAAACTCCTGACACAGGG - Intronic
906638491 1:47426627-47426649 ATAATGAAACATCTGAAAAAGGG - Intergenic
906956458 1:50379275-50379297 ACACTTAAACATCAGAGGCAAGG + Intergenic
907911166 1:58828044-58828066 AGAGTTAAACATTTAATACAAGG + Intergenic
908260031 1:62333238-62333260 ATAGCAAAACACCTGAGACTAGG - Intergenic
908381151 1:63597974-63597996 ATTTTTAAAAATTTGAGACATGG + Intronic
909448536 1:75773754-75773776 ATAGATAGACTTTTGAGACAGGG - Intronic
909926923 1:81448469-81448491 ATAAAGAAATATCTGAGACAGGG - Intronic
911327581 1:96486892-96486914 ATAGTCATACATCAGCGACATGG - Intergenic
912269858 1:108198197-108198219 ATAGTGGAATATCTGAGACAGGG - Intronic
912838681 1:113019738-113019760 AAGGTTTAACATCTGTGACAAGG - Intergenic
914207190 1:145542805-145542827 AAAGTAAAATATCTGAAACATGG - Intergenic
914870303 1:151468153-151468175 ATGGTTAAGAATGTGAGACAAGG + Intergenic
916391977 1:164341254-164341276 ATACTTAAACATCAGAAATAAGG - Intergenic
918970002 1:191401789-191401811 ATAATTTAACATGTGAGACCTGG - Intergenic
919467612 1:197941376-197941398 ATAGTTTGATATCTGGGACATGG + Intergenic
921091637 1:211848981-211849003 ATAAATAAATATCTGAGACTAGG - Intergenic
921448955 1:215279939-215279961 ATAGTTAATGATCTGAGATTAGG + Intergenic
922526995 1:226311601-226311623 ATAACAAAACATCTGAGACTGGG + Intergenic
1062967434 10:1618710-1618732 GTAGTTAAAAATCTGTGACGTGG + Intronic
1066089688 10:32005184-32005206 CTAGTTAGACATCAGAGACACGG - Intergenic
1066196860 10:33108713-33108735 AAAGTTACACAGCTCAGACATGG + Intergenic
1068472794 10:57486499-57486521 GTAATTAATCATCAGAGACAAGG + Intergenic
1068665083 10:59665437-59665459 ATGGATAATCATCTGAGTCATGG - Intronic
1068850808 10:61737899-61737921 ATAGGTAAACATGTGTCACAGGG - Intronic
1068905562 10:62317858-62317880 TTTGATAAACATCTCAGACATGG + Intergenic
1069028708 10:63572368-63572390 ATAGATATACATGTGTGACATGG + Intronic
1070568796 10:77625047-77625069 ATAAATAAACATTTGAGAAAAGG - Intronic
1071338221 10:84619278-84619300 ATAAATAAACACCTGAGACTGGG - Intergenic
1071746129 10:88421417-88421439 AAAGCTAATCATCTGTGACACGG + Intronic
1072729407 10:97835406-97835428 ATAATAAAATACCTGAGACACGG + Intergenic
1073234064 10:101998361-101998383 ATAGCTGAACCTCTGAGACTTGG - Intronic
1073817494 10:107223916-107223938 ACAATTACACATGTGAGACATGG - Intergenic
1074684058 10:115942259-115942281 ATTGCTAAACATCTTAAACATGG + Intronic
1075357064 10:121789184-121789206 AAAGTGAGAAATCTGAGACAAGG + Intronic
1080788299 11:35496083-35496105 TCAGTAAAACATCAGAGACATGG - Intronic
1081111670 11:39142708-39142730 ATAATTAAACTTCTCAGACATGG + Intergenic
1081522259 11:43893861-43893883 ATAAATAAAAATCTGAGAAAGGG - Intronic
1081549966 11:44101788-44101810 GCAGTTAATCATCAGAGACAAGG + Intronic
1081947714 11:47013299-47013321 ATAGATAAACATGTGTGCCATGG + Intronic
1084841714 11:71856941-71856963 ATATTTAAACTTCTGAATCATGG - Intergenic
1085654541 11:78301013-78301035 ATCGTTAATCATCAGAGAAATGG - Intronic
1086074330 11:82834234-82834256 ATAGCAAAACACCTGAGACTGGG - Intronic
1086163577 11:83750917-83750939 CTAGTAAAATATCTGATACACGG - Intronic
1086495095 11:87395406-87395428 ATAGGTATACATCAGAGATATGG - Intergenic
1086577464 11:88356499-88356521 ATAGTTAAACATAAGAGGCAAGG + Intergenic
1087379922 11:97392186-97392208 GCTGTTAAACATCAGAGACATGG - Intergenic
1087449226 11:98296379-98296401 ATAATTAAATACCTGAGACTGGG - Intergenic
1087706804 11:101502665-101502687 GTAGGTAAGAATCTGAGACAGGG + Intronic
1088083150 11:105944924-105944946 CTAGAAAAACATCTGAGAAATGG - Intronic
1089143273 11:116305342-116305364 AGAGTTAAACCTCTGAGAAGGGG - Intergenic
1093385037 12:18542455-18542477 ATAGGTAAACTTCTGTCACAGGG + Intronic
1093416716 12:18928705-18928727 ATATTTAATCATCAGAGGCAAGG + Intergenic
1094167544 12:27458033-27458055 ATTGTTAAACGTCTGAGAAAAGG + Intergenic
1095632049 12:44388951-44388973 ATGGTTGAACATCAGATACATGG - Exonic
1095857132 12:46872661-46872683 ATATTTTTACATCTGAGAAAAGG - Intergenic
1096162045 12:49386888-49386910 AAATTTAAAGAACTGAGACAAGG + Intronic
1098486748 12:71030351-71030373 ATAGTTAAAATTCTGACACTTGG + Intergenic
1099860221 12:88217304-88217326 ATAGGTAAACATTTGTCACAGGG + Intergenic
1100133846 12:91529589-91529611 CTAGTTATATATCTAAGACAAGG - Intergenic
1101582730 12:106057955-106057977 ATAATTGAATATCTGAGACTGGG + Intergenic
1101842348 12:108337314-108337336 TTAGGTAAACATCTAAGAGATGG + Intronic
1102931644 12:116866906-116866928 ATAGTATAACATGTGGGACATGG - Intronic
1103196996 12:119052822-119052844 ACAGTTAAACATCTTAGGCCAGG - Intronic
1104901863 12:132193764-132193786 ATAAAGGAACATCTGAGACAGGG + Intergenic
1105585240 13:21737489-21737511 ACAGCTACACATCTTAGACATGG - Intergenic
1106850062 13:33780769-33780791 ATAAGTAAATATCTGAGACTGGG + Intergenic
1107577046 13:41736635-41736657 ATAGTTAAACATAAGAGTAAAGG + Intronic
1107708435 13:43129801-43129823 TAAGTTAAACATTTGAGTCAAGG + Intergenic
1107817840 13:44260101-44260123 ATAGCAAAACATCTGATTCAGGG + Intergenic
1107996406 13:45865387-45865409 ATAGTCACACATATGAGGCAGGG + Intergenic
1109531044 13:63648081-63648103 ATAACAAAACATCTGAGACCAGG - Intergenic
1109601215 13:64631324-64631346 ATTGTAAAACATCTGTGCCATGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110355915 13:74567234-74567256 CGAGTTAAACATCCCAGACATGG - Intergenic
1112229622 13:97575516-97575538 ATAAAGAAACGTCTGAGACAAGG + Intergenic
1113015137 13:105820696-105820718 ATTGCAAAACATCAGAGACATGG - Intergenic
1114748733 14:25179930-25179952 ATATTTATATATTTGAGACAGGG - Intergenic
1115926618 14:38442875-38442897 ATAGGTAAACATGTGTCACAGGG + Intergenic
1116327311 14:43546844-43546866 ATAATTACACATCTGAGAAAAGG + Intergenic
1116354586 14:43912840-43912862 ATAAATAAATATCTGAAACAGGG - Intergenic
1116535663 14:46026228-46026250 ATAGATAAACATGTGTCACAGGG + Intergenic
1116666671 14:47785208-47785230 ATAGTGAAACAACTTAGGCAAGG - Intergenic
1116916499 14:50531475-50531497 ACAGTTAAAGCTCAGAGACAGGG + Intronic
1117567003 14:57003483-57003505 ATAAAAAAAAATCTGAGACATGG - Intergenic
1118402035 14:65389006-65389028 ATATTTATATATTTGAGACAGGG + Intergenic
1119491398 14:75036882-75036904 ATATTGCAATATCTGAGACATGG - Intronic
1120407971 14:84113487-84113509 ATAACAAAACATCTGAGACTCGG - Intergenic
1121974976 14:98394669-98394691 ATTGTTGAACATCTGATAGAAGG - Intergenic
1124055369 15:26237007-26237029 ATAGCAAAATATCTGAGACTGGG - Intergenic
1126964013 15:54030621-54030643 ATAACAAAATATCTGAGACAGGG + Intronic
1129590756 15:76912795-76912817 ATACTTAACCAACAGAGACAGGG + Intergenic
1130654599 15:85783394-85783416 ATATTTAAACATCTTAGGCCAGG + Intronic
1131920532 15:97323252-97323274 ATAGTAAAACAAGTGAGAAATGG - Intergenic
1132763204 16:1521124-1521146 AAAGTTAAATTTTTGAGACAGGG + Intronic
1134181225 16:12049314-12049336 AAAGTTAAAAAATTGAGACAGGG - Intronic
1134647610 16:15882583-15882605 ATAAATAAACACCTGAGACTGGG - Intronic
1135127680 16:19824550-19824572 ATAGTTAGAGAGCTGAGTCAGGG + Intronic
1135307964 16:21383071-21383093 AAAGTTAAAAAATTGAGACAGGG - Intergenic
1136304709 16:29362191-29362213 AAAGTTAAAAAATTGAGACAGGG - Intergenic
1136694152 16:32061869-32061891 ATATTTCAACATCAGATACATGG - Intergenic
1138007484 16:53351410-53351432 ATAGCAAAACACCTGAGACTGGG + Intergenic
1138830224 16:60366498-60366520 ATAATTAAACATATGATACACGG - Intergenic
1138920047 16:61516301-61516323 ATAGTGAATCATTTGAGACCAGG + Intergenic
1140397750 16:74643406-74643428 ATTGTTAAAAATCTAAGGCAAGG - Intronic
1140609591 16:76581956-76581978 ATAAATAAATACCTGAGACAAGG - Intronic
1140648344 16:77059461-77059483 ATAGTTAAACATCTCAAATTAGG - Intergenic
1140737602 16:77911960-77911982 ATATTTAGACATATGACACATGG + Intronic
1140930282 16:79621228-79621250 ATGTTTAATCATCTGAGAAATGG + Intergenic
1141029041 16:80571858-80571880 ATAAAGAAACATCTGAGACTGGG + Intergenic
1141201576 16:81902502-81902524 ATAAATAACCATCTGGGACATGG + Intronic
1203096911 16_KI270728v1_random:1266783-1266805 ATATTTCAACATCAGATACATGG - Intergenic
1143743436 17:8971683-8971705 ATAGAGAAACACCTGAGACTGGG - Intergenic
1143814016 17:9496662-9496684 AAGGTTAAAAATCTGAGACGGGG + Intronic
1144182856 17:12769120-12769142 AAAGTTACACAACTGAGAAATGG + Intergenic
1144519075 17:15942477-15942499 ATAGGGAAATATCTGAGACTGGG - Intergenic
1146193818 17:30794038-30794060 GGAGTTAAAGATCTGAGATATGG - Intronic
1147276973 17:39326234-39326256 ATAATTAAATACCTGAGACTGGG - Intronic
1148992498 17:51678657-51678679 ACAGGTGAACATCTAAGACAGGG + Intronic
1149178250 17:53901400-53901422 ATACATAAATATCTGAGACTGGG - Intergenic
1150017509 17:61573138-61573160 ATAGTTAAGCAACTAAGAAACGG - Intergenic
1150409016 17:64926861-64926883 TCAGTTCAACATCTGGGACATGG - Intergenic
1152443828 17:80328456-80328478 AACGTGAAACATCTGATACAAGG + Exonic
1152850943 17:82635216-82635238 ATAGTTACACTTCTGACACCTGG - Intronic
1154103054 18:11494438-11494460 AAGGTAAAATATCTGAGACATGG - Intergenic
1154208356 18:12356950-12356972 TTACTTAAACATCTGAGCTATGG + Intronic
1154532491 18:15361753-15361775 GAAGTGAAATATCTGAGACAAGG + Intergenic
1155541980 18:26878285-26878307 ATAATAGAACATCTGAGACTGGG - Intergenic
1157034471 18:43954272-43954294 ATAGTGAAACACCTGAGACTGGG - Intergenic
1158038658 18:53066745-53066767 ATAGAGAAATATCTGAGACTGGG + Intronic
1159121940 18:64181132-64181154 ATAGTTATAGAACTGAGAAAGGG - Intergenic
1159392120 18:67806770-67806792 ATAGTAAAATATTTGAGACTGGG - Intergenic
1159539273 18:69754958-69754980 ACATTTAGACATCTGAGAAATGG + Intronic
1160198851 18:76779461-76779483 ATAGCAAAATATCTGAGACCGGG - Intergenic
1160291903 18:77602684-77602706 ATAAAGAAACATCTGAGACTGGG + Intergenic
1165086723 19:33354176-33354198 ATAGATATACTTTTGAGACAGGG - Intergenic
925727569 2:6888573-6888595 ATATTTACACATCTGAAAAAAGG - Intronic
928372439 2:30750400-30750422 ATAGGTAAACATGTGTCACAGGG - Intronic
928828518 2:35449227-35449249 ATATTGAAACCTCAGAGACATGG - Intergenic
929283926 2:40114570-40114592 ATATTTAAACATGTGATACCTGG - Intronic
930709685 2:54538896-54538918 ATAGGTAAACATGTAACACAGGG - Intronic
935679300 2:105622111-105622133 ATAGTAAAACATGACAGACATGG + Intergenic
936237261 2:110753334-110753356 ATAGAGGAACATCTGAGACTGGG - Intronic
936756861 2:115724701-115724723 ATAGAGAAACACCTGAGACTGGG + Intronic
938179465 2:129167034-129167056 ATAGCAAAATACCTGAGACAGGG - Intergenic
938850256 2:135252287-135252309 ATAGGTAAACATGTGTCACAGGG - Intronic
939432126 2:142124087-142124109 ATAGGTAAACATGTGTAACAAGG + Intronic
939924661 2:148158380-148158402 CCATTTAAACCTCTGAGACAAGG - Intronic
941170324 2:162128152-162128174 ATAATTTGACATGTGAGACAAGG + Intergenic
943091488 2:183380914-183380936 TTAGTTAATTATTTGAGACAGGG + Intergenic
943322382 2:186461575-186461597 ATAGGTAAACATGTGTCACAGGG - Intergenic
945339602 2:208636431-208636453 ATAGTTAGATATCAGAAACAAGG + Intronic
945382891 2:209162664-209162686 ATAGTTAAACTTGTGACATAGGG + Intergenic
945912287 2:215663196-215663218 AGAGTAAAACAGTTGAGACAAGG + Intergenic
948176224 2:235945714-235945736 ATAAATAAACACCTGAGACTGGG + Intronic
1170544388 20:17422345-17422367 ATAGTTATAAATCTAAGAAAAGG + Intronic
1170734853 20:19005839-19005861 ATTGCAAAAAATCTGAGACAGGG - Intergenic
1173015007 20:39216786-39216808 ACATTAAAACATGTGAGACAGGG - Intergenic
1174091883 20:48055686-48055708 ACAGTAAGACAACTGAGACATGG - Intergenic
1175489312 20:59368602-59368624 AGACTTAAACATTTGGGACAAGG - Intergenic
1176904453 21:14482985-14483007 ATAAATAAACATATGAGACTGGG + Intergenic
1177165271 21:17594938-17594960 ATAGGTAAACATGTGTCACAGGG - Intronic
1177554956 21:22677073-22677095 ATAAATAATAATCTGAGACAAGG - Intergenic
1177685654 21:24434450-24434472 ATAGGTAAACATGTGTCACAGGG + Intergenic
1180645695 22:17337063-17337085 ATGGTTAACCATCTGAGGCAAGG + Intergenic
1182161286 22:28124339-28124361 CTAGCTATAGATCTGAGACAGGG - Intronic
1182168281 22:28199174-28199196 ATATTTAAAAATCTAAGAAATGG + Intronic
1182365245 22:29774394-29774416 ATTCATAAACATCTGAGACCAGG - Intergenic
1183249677 22:36721360-36721382 ATATTTAAAAAACTGAGGCACGG - Intergenic
951220840 3:20067679-20067701 TTTTTTAAACTTCTGAGACAGGG + Intronic
952052888 3:29407475-29407497 ATAGTCAAAAATCTTAGTCAAGG + Intronic
955222303 3:57033096-57033118 AAAGCTAAAGATCTGAGGCATGG + Intronic
956075293 3:65498478-65498500 ATAAGTGAACATCTGAGAAATGG - Intronic
957017887 3:75091232-75091254 ATAGAGAAATATCTGAGACTGGG + Intergenic
957715613 3:83926586-83926608 ATAAATAAATAACTGAGACATGG - Intergenic
958496887 3:94856290-94856312 ATAGATAAACATGTGTTACAGGG + Intergenic
959262121 3:104095806-104095828 ATAATTAAGCACCTGAGAGAAGG + Intergenic
959267372 3:104159531-104159553 CTAGTTGAAGATCTGAGAGAAGG - Intergenic
960082967 3:113560584-113560606 ACAGTTAAACATTTGAAAAAAGG + Intronic
960274335 3:115710507-115710529 ATAGTTGAATATCAGTGACATGG + Intronic
960690023 3:120336699-120336721 ATAGGTTAACATTTTAGACATGG + Intronic
961512977 3:127414295-127414317 ATAGTTTATCTTCTGAAACAGGG + Intergenic
962901940 3:139769109-139769131 ATAAATAAAAACCTGAGACAAGG - Intergenic
963515124 3:146299854-146299876 ATAATAAAATACCTGAGACAAGG + Intergenic
963612424 3:147487127-147487149 ATAGTTATACATATTTGACAAGG + Intronic
964010986 3:151891349-151891371 ACAACTGAACATCTGAGACAGGG + Intergenic
964107949 3:153059023-153059045 TTTGTTAAACATCTGACACTTGG + Intergenic
964124381 3:153220676-153220698 ATATTCAAACACGTGAGACAAGG + Intergenic
964836529 3:160945261-160945283 AGAGTTGAGCAGCTGAGACAGGG - Intronic
966294023 3:178396644-178396666 ATAGTAAAACTTCTCAAACAAGG - Intergenic
966450531 3:180055175-180055197 ATACATATACATATGAGACAAGG + Intergenic
967571135 3:191029463-191029485 AGAGTTAATCTCCTGAGACAGGG + Intergenic
967592811 3:191298599-191298621 ATAAAGAAACATCTGAGACAGGG - Intronic
967681482 3:192369078-192369100 ATAGTTCAGCAGCAGAGACAGGG - Intronic
969782815 4:9422974-9422996 ATATTTAAACTTCTGAATCATGG - Intergenic
969828334 4:9775806-9775828 ATAAAGAAATATCTGAGACAAGG - Intronic
971103855 4:23499551-23499573 ATAGATAAATACCTGAGACTGGG - Intergenic
971188331 4:24402561-24402583 ATAATTAAACACCAGAGCCAGGG + Intergenic
971995268 4:33956303-33956325 ATAGCTAAACATGTGTCACAGGG + Intergenic
972146428 4:36032722-36032744 ATAGGTAAACTCCTGACACAAGG + Intronic
972206079 4:36774410-36774432 ATTCTTAGACATCTGAGAGAAGG + Intergenic
972987723 4:44785158-44785180 ATAGTAAAATACCTGAGACTAGG + Intergenic
974611540 4:64224544-64224566 ATAAAGAAATATCTGAGACAGGG + Intergenic
976045471 4:80941626-80941648 ATAAAGAAACATCTGAGACTGGG + Intronic
976446441 4:85135357-85135379 ATAATGAAATACCTGAGACAGGG - Intergenic
976793364 4:88905454-88905476 ATAGGTAAACATGTGTCACAAGG + Intronic
977176212 4:93822834-93822856 ACATTTAAACACCTGTGACACGG - Intergenic
977178771 4:93846867-93846889 ATAAATAAATACCTGAGACAAGG - Intergenic
977545599 4:98372689-98372711 TTACTTAAAAATTTGAGACACGG + Intronic
978260135 4:106746110-106746132 ATAAAGAAATATCTGAGACAGGG - Intergenic
978926017 4:114245721-114245743 ATACATAAATATCTGAGACTAGG + Intergenic
979117043 4:116838033-116838055 ATGGATAAATATCTGATACATGG - Intergenic
980153830 4:129080803-129080825 ATAAAGAAACATCTGAGACTGGG + Intronic
980870941 4:138610024-138610046 AAAGTGGAACATCTGAGTCATGG + Intergenic
980995663 4:139777531-139777553 ATATTTATTTATCTGAGACATGG + Intronic
981181399 4:141750064-141750086 ATAGGTAAACATGTGACTCAGGG - Intergenic
981564942 4:146090478-146090500 ACATTTAAATACCTGAGACAAGG - Intergenic
982598458 4:157415135-157415157 ATTTTAAAATATCTGAGACAGGG + Intergenic
983091834 4:163513120-163513142 AGAGTTAAACATCAGATAGATGG - Intronic
983783508 4:171702422-171702444 AATGTTAAAGATGTGAGACATGG - Intergenic
986079272 5:4372702-4372724 TCAGTTCAACATGTGAGACAGGG + Intergenic
986756087 5:10838050-10838072 AAGGGTAAACATCTGAGAGAGGG - Intergenic
987007459 5:13724942-13724964 ATAAATAAATATCTGAGACTGGG - Intronic
988115416 5:26882159-26882181 TTAGTTAAACCTATGAGATACGG - Intronic
988196022 5:28007135-28007157 ATAGTTAAACATCTGCTTCTTGG + Intergenic
989099420 5:37810454-37810476 ATATTTACTCATCTAAGACAAGG - Intergenic
989447281 5:41544991-41545013 ATAGGTAAACATCACAGAAATGG - Intergenic
991229093 5:64310014-64310036 ATAGATACCCATCTGAGAAAGGG - Intronic
991545392 5:67776083-67776105 ATATCTAAAAATCTAAGACATGG + Intergenic
991647511 5:68816040-68816062 ATGGTTAAGAATCTGAAACAGGG + Intergenic
991963768 5:72071190-72071212 ATAGTTGAACATCTGATATGTGG - Intergenic
993193746 5:84712735-84712757 ATAGTTTAACAAATGAGAAAAGG - Intergenic
993677749 5:90837805-90837827 AAAGTTAAATTTCTGAAACAAGG - Intronic
994152420 5:96463009-96463031 ATAAAGAAACATCTGAGACTCGG - Intergenic
995347207 5:111134557-111134579 ATAGAACAGCATCTGAGACAGGG - Intergenic
995350302 5:111167297-111167319 ATAGTAAAATATATGAGACCAGG - Intergenic
996761076 5:126986199-126986221 ATTATTAAACATTTCAGACAGGG + Intronic
996784357 5:127222657-127222679 ATAGATAAACATGTGTCACAGGG - Intergenic
998047235 5:138998142-138998164 ATAAAGAAACATCTGAGACTGGG + Intronic
998623342 5:143818624-143818646 ATAGTTAAACCTCTGAAATTTGG + Intronic
998944487 5:147323109-147323131 AAAGTTAAACACCTGACAAATGG - Intronic
999057310 5:148592329-148592351 ATAGGTAAACATATGGGGCATGG - Intronic
1001993852 5:176138419-176138441 TTATTTAAAAATCTGAGACTAGG - Intergenic
1002083952 5:176758049-176758071 ATAGATAAACATGTGTCACAGGG - Intergenic
1003631658 6:7792917-7792939 ATATTTGAGCATCTGATACATGG - Intronic
1004799726 6:19133083-19133105 AGAATGAAAGATCTGAGACAGGG + Intergenic
1004862480 6:19819307-19819329 AGAGTTAAAAATGTGAGGCAGGG - Intergenic
1008789707 6:55215871-55215893 ATAACTAAACATCTGAGACTAGG + Intronic
1009547204 6:65034743-65034765 ATAAATAAATATCTGAGACTGGG - Intronic
1010180112 6:73076455-73076477 ATAAGTAAACATCTGAGTGATGG - Intronic
1010618165 6:78040500-78040522 ATAAATAAATATCTGAGACTGGG + Intergenic
1010828767 6:80505225-80505247 ATAATTGAACATATGACACAGGG - Intergenic
1010910409 6:81548347-81548369 ATTGTTGAAGATCTGAGCCAGGG - Intronic
1011716958 6:90116554-90116576 ATAGATAAACATGTGTCACAGGG - Intronic
1012977006 6:105791802-105791824 ATAGTTGCCCATCTGGGACAAGG - Intergenic
1013544234 6:111140099-111140121 ATAGATAAACATGTGTCACAGGG - Intronic
1015499726 6:133919935-133919957 AAATTTATACATCTGAGCCAAGG + Intergenic
1015541440 6:134317933-134317955 GTAGTTAAGCAGCTGAGAGAAGG + Exonic
1016023938 6:139265370-139265392 ATTGATAAAAGTCTGAGACATGG - Intronic
1016500078 6:144710628-144710650 ATACATAAACATTTGAGACCTGG + Intronic
1017552329 6:155522538-155522560 ATAAAGAAACATCTGAGACTGGG + Intergenic
1018608405 6:165623131-165623153 ATAAATAAACACCTGAGACTGGG - Intronic
1019402159 7:861571-861593 ACTTTTAAACATCTGAGAAAGGG + Intronic
1020933296 7:14427558-14427580 ATAGAGACATATCTGAGACAGGG + Intronic
1022145656 7:27537312-27537334 ATAGTTAAACATCTGAGACAAGG + Intronic
1022220288 7:28307540-28307562 ATAGTAAAACACCTTAGACTGGG - Intronic
1022641970 7:32195677-32195699 ATTTTTAAAAATTTGAGACAGGG - Intronic
1024125782 7:46293318-46293340 ATAGTTAAACAACTGAAACAAGG - Intergenic
1024767544 7:52678331-52678353 ATAATTAAATACCTGAGACTGGG + Intergenic
1024842314 7:53601883-53601905 ATAAATAAATATCTGAGACTGGG + Intergenic
1026287493 7:68976086-68976108 ATAAAGAAACATCTGAGACTGGG - Intergenic
1026364228 7:69631400-69631422 ATAGTTTAACATCTGGGTCAGGG + Intronic
1027739634 7:81984571-81984593 GTATTTAAACATCTGATACTAGG + Intronic
1027848814 7:83422602-83422624 ATAGTCAAACATCAGCGTCATGG + Intronic
1029716958 7:102334141-102334163 ATATTTAAAAATTGGAGACAAGG + Intergenic
1030436800 7:109531952-109531974 ATAACAAAATATCTGAGACAGGG - Intergenic
1030599598 7:111578578-111578600 ATAATTAATCATCAGAGAAATGG + Intergenic
1033503424 7:141976656-141976678 ATAGTTAAATATCTTGGCCAAGG + Intronic
1034080639 7:148274760-148274782 ATAAAGAAACATCTGAGACTGGG - Intronic
1037294465 8:17385888-17385910 ATAAATAAATATCTGAGACCGGG - Intronic
1038050569 8:23806516-23806538 ATATTTAAACATATGGTACATGG + Intergenic
1040498340 8:47986484-47986506 ATAATAAAATATCTGAGACTGGG + Intergenic
1041875174 8:62679496-62679518 ATAAATAAATATCTGAGACTAGG + Intronic
1042789007 8:72582374-72582396 GAAGTGCAACATCTGAGACAGGG - Intronic
1042852945 8:73234711-73234733 ATTGCTACACATCTAAGACAGGG + Intergenic
1044103093 8:88165681-88165703 ATAATAAAACATCTGGAACATGG - Intronic
1044377257 8:91490312-91490334 ATAGATACACATCGTAGACAAGG - Intergenic
1044761324 8:95520701-95520723 ATAAATAAATATCTGAGACTGGG + Intergenic
1045365777 8:101474595-101474617 ACAGCTAGACAGCTGAGACAAGG + Intergenic
1045436785 8:102171969-102171991 ATAAATAAAGATCTGAGAAAGGG + Intergenic
1046409387 8:113819443-113819465 ATAGGTAAACATATGTCACAGGG + Intergenic
1047119535 8:121885593-121885615 ATAGTTAAACTTCTGGTTCAGGG + Intergenic
1047977465 8:130145292-130145314 ATAGTAAAACATCTGAGCTATGG + Intronic
1048153362 8:131916019-131916041 GTAGTTAAACTGATGAGACAGGG + Intronic
1050602171 9:7264043-7264065 CTAGTTAATCAGCTGAGTCAGGG + Intergenic
1050819387 9:9858614-9858636 ATAATTAAGAAACTGAGACACGG - Intronic
1050907931 9:11028281-11028303 ATAGATAAACACCTGAGATAGGG + Intergenic
1051099590 9:13505773-13505795 ATAGATACTCCTCTGAGACAGGG - Intergenic
1051274677 9:15387324-15387346 ATAAAGAAACATCTGAGACTGGG - Intergenic
1052194462 9:25694570-25694592 AAAGTTAAACGTCTCATACAGGG - Intergenic
1053624157 9:39851763-39851785 AAAGTTAAACCTCTTAGAAATGG + Intergenic
1053880709 9:42591465-42591487 AAAGTTAAACCTCTTAGAAATGG - Intergenic
1054219740 9:62398935-62398957 AAAGTTAAACCTCTTAGAAATGG - Intergenic
1054230975 9:62510238-62510260 AAAGTTAAACCTCTTAGAAATGG + Intergenic
1054783070 9:69184013-69184035 AAAGTTAAACATCTGTAACCTGG - Intronic
1055120123 9:72650547-72650569 ATAGGTAAACATGTGTCACAGGG + Intronic
1055687862 9:78797024-78797046 AATGTTAAAAATCTCAGACAAGG + Intergenic
1058293730 9:103278628-103278650 ATAAATAAATATCTGAGACTGGG + Intergenic
1058374178 9:104304423-104304445 ATAAAGAAATATCTGAGACAGGG - Intergenic
1059263469 9:113003039-113003061 ATAGCAAAATACCTGAGACAGGG - Intergenic
1059646628 9:116274579-116274601 AAAGTTACACATCTAAGTCATGG - Intronic
1059975589 9:119713449-119713471 ATAGGTAAACATATGTCACAGGG + Intergenic
1061344227 9:130009295-130009317 ATAGTTGAGCATCTGACTCAAGG + Intronic
1185988704 X:4867826-4867848 TAAGTTAAACATCTAAGACTGGG - Intergenic
1186168766 X:6855487-6855509 ATGGATAAACATCTAAGACAGGG - Intergenic
1186685620 X:11922121-11922143 ATAAAGAAACATCTGAGACTGGG + Intergenic
1187695369 X:21913879-21913901 ATAGCTAAACAACTAAGCCAAGG - Intergenic
1188523356 X:31062482-31062504 ATTGTGAAACATATTAGACATGG + Intergenic
1191028606 X:55942727-55942749 AGAGTTAGACATGTGAAACATGG + Intergenic
1192373820 X:70538734-70538756 AAGGTTAAATATCTGACACAAGG - Intronic
1193235620 X:79103653-79103675 AAAGTGAAAGATCTGACACAAGG - Intergenic
1193928307 X:87518619-87518641 GCATTTAAACATCTGAGCCACGG - Intronic
1194560202 X:95410956-95410978 ATAGTGACATATCTGAGACTGGG - Intergenic
1194866336 X:99073196-99073218 AAATTTGAAAATCTGAGACAGGG - Intergenic
1195551837 X:106180342-106180364 ATATTTAAAAATCTAAGAAAAGG - Intronic
1196130913 X:112155171-112155193 ATAATAAAATATCTGAGACTGGG - Intergenic
1196291080 X:113941990-113942012 ATAGTTTAAAATCTGATAAAAGG + Intergenic
1197078638 X:122384587-122384609 ATATTTAAACATATGAACCACGG + Intergenic
1198315446 X:135461411-135461433 ATAAATAAATATCTGAGACTGGG + Intergenic
1198714817 X:139545972-139545994 ATAGATAAACATGTGTCACAGGG + Intronic
1200411081 Y:2862136-2862158 ATGCTTAAACCTCAGAGACAGGG - Intronic
1201255721 Y:12106513-12106535 ATTGTTGAACATGTGGGACATGG + Intergenic