ID: 1022154900

View in Genome Browser
Species Human (GRCh38)
Location 7:27650371-27650393
Sequence CACTTGCCATTTAAAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022154900_1022154901 -10 Left 1022154900 7:27650371-27650393 CCATAGGCTTTAAATGGCAAGTG 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1022154901 7:27650384-27650406 ATGGCAAGTGTAACAGTATCAGG 0: 1
1: 0
2: 0
3: 3
4: 119
1022154900_1022154902 -3 Left 1022154900 7:27650371-27650393 CCATAGGCTTTAAATGGCAAGTG 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1022154902 7:27650391-27650413 GTGTAACAGTATCAGGACCTTGG 0: 1
1: 0
2: 2
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022154900 Original CRISPR CACTTGCCATTTAAAGCCTA TGG (reversed) Intronic
903918747 1:26784399-26784421 CACTCATCATTTAAAGCCCATGG - Intergenic
905776404 1:40670223-40670245 AACATGGAATTTAAAGCCTATGG + Intergenic
907109382 1:51912969-51912991 GACTTGGCATCTAAAGCCTCGGG + Exonic
915825086 1:159067369-159067391 CACTTGCCATTTAGAACCAAAGG + Intronic
917410008 1:174749696-174749718 CATTTGCCATTTATTGCCTCTGG - Intronic
917482203 1:175422131-175422153 CTCTTGACATTCAAAGACTATGG - Intronic
919085174 1:192912389-192912411 CACTTTCCACTTCATGCCTAAGG + Intergenic
922755102 1:228091808-228091830 CACCAGCCAAATAAAGCCTATGG - Intronic
924283759 1:242464243-242464265 TACTTGCCATTGAAATCCTTGGG - Intronic
1070872454 10:79768583-79768605 CACATGGTATTTAAAGCCTTGGG + Intergenic
1071639375 10:87290735-87290757 CACATGGTATTTAAAGCCTTGGG + Intergenic
1071655862 10:87447214-87447236 CACATGGTATTTAAAGCCTTGGG - Intergenic
1076083048 10:127600648-127600670 CACTTCACACTTACAGCCTACGG + Intergenic
1079647749 11:22888245-22888267 CACTTTACATTTAAAGTCCATGG - Intergenic
1079984988 11:27190737-27190759 CACTTGACATTTTAACCATAAGG + Intergenic
1080683108 11:34494298-34494320 CAGCTGCCCTTTAAAGCATAGGG - Intronic
1082991417 11:59210631-59210653 CACTTGCCATTTCAATGCTTAGG + Exonic
1083000551 11:59287250-59287272 CACTTGCCATTTCAACACTTAGG + Intergenic
1085473983 11:76777720-76777742 CACTAGCCCTTTAAATCCTTTGG + Intergenic
1088798381 11:113283811-113283833 CACTTGGCATTGGCAGCCTAGGG - Intergenic
1097186836 12:57200591-57200613 CAGTGGCCATTCAAAGCCTCAGG - Intronic
1098660090 12:73082405-73082427 CACTAGCCATTTAAATCCTATGG - Intergenic
1100088525 12:90940232-90940254 CTCTTGACAGTTAAAGCCTTAGG + Intronic
1102550218 12:113686027-113686049 CACTTGCCATTTTACACATAGGG - Intergenic
1111285162 13:86081566-86081588 CATGTGACATTTAAAGCCAATGG - Intergenic
1117089021 14:52231079-52231101 CACTTCCCATTTAAAGTTGATGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1119696414 14:76717100-76717122 GACTTGCCCTTTTATGCCTAAGG - Intergenic
1121043042 14:90765908-90765930 CACTGGCCCTTTAAATCCTCTGG - Intronic
1126240215 15:46433280-46433302 CCCTTGCCAATTCATGCCTATGG - Intergenic
1129375033 15:75124528-75124550 CACTGGCCATTTACATCCCAGGG + Intergenic
1131863892 15:96686203-96686225 TACTGGCCATGTAAATCCTAAGG - Intergenic
1133427209 16:5703110-5703132 CACATGGCATTTACAGTCTAAGG + Intergenic
1135178033 16:20248460-20248482 CACTTTACATTTGATGCCTAGGG - Intergenic
1138734974 16:59240033-59240055 CTCTTGCCCCTTCAAGCCTAAGG - Intergenic
1140496180 16:75390828-75390850 CTCTTGCCCTTTCAGGCCTAGGG + Intronic
1143321710 17:6072610-6072632 CACCTGCATTTTAAGGCCTAAGG - Intronic
1144308046 17:13987057-13987079 CCCTTGCCATTTAAACACCAGGG + Intergenic
1149957999 17:61075280-61075302 CACAATCCATTTAAAGCCTTAGG + Intronic
1153305279 18:3625164-3625186 CACTGGGCATTTAATGACTAGGG - Intronic
1154442685 18:14406580-14406602 CACTGGACATCTAAAGACTATGG + Intergenic
1156334498 18:36156721-36156743 TATATTCCATTTAAAGCCTAAGG - Intronic
1165544289 19:36521119-36521141 CTCTTGCCCCTTAAAGCCCAAGG + Intronic
1166398774 19:42462479-42462501 CACTTCCCACTTTAAGCCTCTGG - Intergenic
926527885 2:14005552-14005574 CATTTGCCATATAAAGCAAAAGG + Intergenic
927595476 2:24393104-24393126 CACTTGCCCCTTGAGGCCTAGGG + Intergenic
929489657 2:42384977-42384999 CAGTTGTCATTTAAAACCTCAGG + Intronic
931943148 2:67275199-67275221 GATTTGCCATTTAAATGCTAAGG - Intergenic
937441326 2:121918533-121918555 CAGTTTCCAGTTAAAGCCAAGGG + Intergenic
942665197 2:178310262-178310284 GACTTGCCCTTTAAAGCATTTGG + Intronic
943849744 2:192703194-192703216 GACATGCCATTTAAAACGTATGG + Intergenic
947175854 2:227366966-227366988 CACTGGCCACTTAAAGCATCAGG - Intronic
1173317470 20:41958051-41958073 CATGTGCCAGTTTAAGCCTAAGG + Intergenic
1174044672 20:47725147-47725169 CATTTGCCATTCAAATCCTTTGG + Intronic
1176888229 21:14282097-14282119 CTCTTGCCATTTAAATACTGAGG - Intergenic
1177923173 21:27180099-27180121 AATTTGCCATTTATAGCCAAGGG + Intergenic
1179440506 21:41390351-41390373 CACTTGTCCTTCAAAGCCCACGG - Intronic
1180647349 22:17350432-17350454 CACTTTCCATTTACAGCATTGGG - Intergenic
950446280 3:13040703-13040725 CCCTTCCCTTTTAAAGCCTCTGG + Intronic
950581072 3:13862441-13862463 CTTTTGCTATTTAAAGCCAATGG + Intronic
951731957 3:25819709-25819731 AACTTGCCATTTAAATCCCCAGG + Intergenic
953297487 3:41734928-41734950 CCCTTGCCATTTAAGGCTTGAGG - Intronic
955967577 3:64404742-64404764 CAATTGTTATTTAAAGACTAGGG + Intronic
960466391 3:118001026-118001048 CACATGCAAATTAAAGCCTCTGG - Intergenic
962674391 3:137743819-137743841 CATGTGCCATTTATAGCCTCCGG + Intergenic
966033822 3:175385184-175385206 CAATTTCCATTCAAAGCATAAGG + Intronic
967541129 3:190668917-190668939 CTCTTGCCACTTTAGGCCTAGGG - Intergenic
970321026 4:14875469-14875491 CACTTGCCATGCAAAGCCTGGGG + Intergenic
971751040 4:30648334-30648356 CAGATGGCATTTAAAGCCTGGGG - Intergenic
973322760 4:48826562-48826584 CAATTACAATTAAAAGCCTATGG + Intronic
973897671 4:55431476-55431498 CACTTGCCATTTTAAGTGTTTGG - Exonic
977069039 4:92359835-92359857 CACTTGCAATTAGAAGCCTAAGG - Intronic
977141822 4:93383139-93383161 CACTGGCCATTTAAATCCCCTGG + Intronic
983415950 4:167454692-167454714 AACTTGACACCTAAAGCCTATGG + Intergenic
986104657 5:4648484-4648506 CCCTTGCCCTTGAAAGCCTGTGG + Intergenic
986647266 5:9929790-9929812 CACTTGTGATTTACAACCTAAGG - Intergenic
986731594 5:10638494-10638516 GTCTTGCCATTTACAGCCAAGGG - Intronic
988211007 5:28203249-28203271 CACTTGACATCTAAAACCAAAGG + Intergenic
988368591 5:30336486-30336508 GTCTTGCCATTTAAATCCAAAGG - Intergenic
988735531 5:34016876-34016898 ACCTTGGCATTGAAAGCCTATGG + Intronic
990103649 5:52227634-52227656 CTCTGAGCATTTAAAGCCTAAGG + Intergenic
992889729 5:81193051-81193073 CACTTTCCTTTTAAAACCTCTGG + Intronic
993219077 5:85066882-85066904 TACTTGCTATTCAAAGCATATGG - Intergenic
994063473 5:95507859-95507881 GAGATGCCATTTTAAGCCTAAGG + Intronic
995851046 5:116545943-116545965 CATTTGCCTTTTAAAGTCAAGGG + Intronic
1008382668 6:50851546-50851568 CACTTGCCATGTGAACCATAAGG + Intergenic
1009791693 6:68410285-68410307 CATTTAGCATTTAAAGCATATGG - Intergenic
1010929288 6:81780993-81781015 CACTTTCCACTTATAACCTAGGG + Intergenic
1013166133 6:107593917-107593939 CACTTGCCTTTTTATGCCTAGGG + Intronic
1019883975 7:3887524-3887546 CAATTGACATTTACAGCCCAAGG - Intronic
1020786767 7:12583396-12583418 CACATACCTTCTAAAGCCTAAGG - Intronic
1022154900 7:27650371-27650393 CACTTGCCATTTAAAGCCTATGG - Intronic
1026011188 7:66637725-66637747 CACTTCCCAGTTAATCCCTACGG - Intronic
1026016448 7:66674791-66674813 CACTTCCCAGTTAATCCCTACGG - Intronic
1029911804 7:104159713-104159735 CCTTTGAGATTTAAAGCCTAGGG - Intronic
1030338930 7:108355586-108355608 GACATGCCATTTAAAACCTATGG - Intronic
1031621159 7:123935666-123935688 CACTTGGGTTTTAAATCCTAAGG - Intronic
1040954396 8:52964959-52964981 CAGTTGCCAGTAAGAGCCTATGG + Intergenic
1041251053 8:55935157-55935179 CACATGACATTTAAACCTTAGGG + Intronic
1044204990 8:89483365-89483387 CTCTTGCCCCTTCAAGCCTAGGG + Intergenic
1044334579 8:90964652-90964674 CACTTGTCTTTTAAATCATATGG - Intronic
1046737142 8:117789301-117789323 CACTGGCCAATCAAAGGCTAAGG - Intergenic
1049178559 8:141208554-141208576 CACCTGCCCTTGAAAGCCTCAGG - Intronic
1049915018 9:309108-309130 CACTTGCCAGTTATACCCTACGG + Intronic
1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG + Intergenic
1056883949 9:90421752-90421774 CATTTGCCAATTAGACCCTATGG - Intergenic
1057088342 9:92232211-92232233 CACTGGTAATTTACAGCCTAGGG + Intronic
1057302640 9:93895685-93895707 CACTTGCCCTTTGAGGCCTCAGG + Intergenic
1058178923 9:101772044-101772066 CACTGGCCAGTGAAAGCCCAGGG - Intergenic
1058309346 9:103482400-103482422 CCCTTGTCTTTTCAAGCCTAAGG + Intergenic
1059943636 9:119383523-119383545 CACTTGCTCTTCAAAGCCAAGGG + Intergenic
1186073968 X:5855792-5855814 CAGTTGCCCTCTAAAGACTAGGG + Intronic
1186287351 X:8059812-8059834 CAGTTGACATTTAATGCATAAGG + Intergenic
1187329848 X:18327706-18327728 CATTTGCCATTTGGAGCCTCAGG + Intronic
1187503949 X:19863755-19863777 CTCTTGCCACTAAAAGCCTCAGG - Intronic
1187921852 X:24211234-24211256 AACGTGCCGTTTAAAGCCTGAGG - Exonic
1188309547 X:28599710-28599732 TTCTTGCCATCTAAAGCTTATGG + Intronic
1190797259 X:53757408-53757430 GACCTGCCATTTATAGCTTAGGG + Intergenic
1194415269 X:93604067-93604089 CACTTGGGATTTTAAGGCTATGG - Intergenic
1199148099 X:144395505-144395527 CAGTTGCCATTTACAGCTTTTGG + Intergenic
1200421977 Y:2979851-2979873 AACGTGCCGTTTAAAGCCTGAGG - Exonic
1201522674 Y:14893556-14893578 CAGTTGCCGTCTAAAACCTAGGG - Intergenic