ID: 1022155482

View in Genome Browser
Species Human (GRCh38)
Location 7:27657925-27657947
Sequence CTTATTATCAATCGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022155482_1022155483 2 Left 1022155482 7:27657925-27657947 CCTGGCACACGATTGATAATAAG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1022155483 7:27657950-27657972 TTAGTTACTCTTACCAAAAATGG No data
1022155482_1022155485 22 Left 1022155482 7:27657925-27657947 CCTGGCACACGATTGATAATAAG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1022155485 7:27657970-27657992 TGGTCAAGTTGTAGCAGTACAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022155482 Original CRISPR CTTATTATCAATCGTGTGCC AGG (reversed) Intronic
901336738 1:8455707-8455729 CTTATTATCAATCCTGCTCCAGG + Intronic
902122520 1:14179124-14179146 CTGAATATCAATCCTGTGTCTGG - Intergenic
906994435 1:50776389-50776411 CTTATTATGAATCATATGGCAGG + Intronic
907570166 1:55476144-55476166 TTTATGAACAATCATGTGCCAGG + Intergenic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
912874120 1:113339296-113339318 CTTGTCATCTATCATGTGCCAGG - Intergenic
920748816 1:208654741-208654763 CTTAGGATCCATGGTGTGCCAGG - Intergenic
922349499 1:224723670-224723692 CTTATTTTCCTTCGTGTTCCTGG + Intronic
1062838130 10:649861-649883 CTTATTATCAAACAGGTGCATGG + Intronic
1066963368 10:42241336-42241358 CTGATCATCTACCGTGTGCCAGG + Intergenic
1069071406 10:63993849-63993871 CCTATTATCCATGGTGGGCCTGG + Intergenic
1075434078 10:122419299-122419321 CTTATTGTCTATCAAGTGCCAGG - Intronic
1090145929 11:124322527-124322549 CTTATTCTCAATCTTGTTCATGG + Intergenic
1090481001 11:127068035-127068057 CTTACTATCAATTATGTTCCAGG - Intergenic
1091698613 12:2644690-2644712 CTTATTTTCATTGGAGTGCCAGG - Intronic
1097260869 12:57719451-57719473 CTGATCATCCATTGTGTGCCAGG - Intronic
1099700967 12:86081233-86081255 CTTACCATCTATAGTGTGCCAGG - Intronic
1104434633 12:128746046-128746068 CTTATAATCACTCCTGCGCCAGG - Intergenic
1105767673 13:23578054-23578076 CTGAGTATCCATCGTGTGCTAGG + Intronic
1108544640 13:51480521-51480543 TTTAATGGCAATCGTGTGCCAGG - Intergenic
1108927187 13:55767459-55767481 CTTATTATAAATGGTTTGCATGG - Intergenic
1109406356 13:61905378-61905400 CTTATTATCAAACGTTAGCCAGG + Intergenic
1123441693 15:20296071-20296093 CTGATCATCTACCGTGTGCCAGG - Intergenic
1133990445 16:10702629-10702651 GATATTATCAATAATGTGCCAGG + Intergenic
1136842862 16:33553879-33553901 CTGATCATCTACCGTGTGCCAGG + Intergenic
1140939103 16:79704398-79704420 TTTAATATTAATTGTGTGCCAGG - Intergenic
1203148063 16_KI270728v1_random:1816003-1816025 CTGATCATCTACCGTGTGCCAGG + Intergenic
1203153027 16_KI270728v1_random:1854177-1854199 CTGATCATCTACCGTGTGCCAGG + Intergenic
1146957560 17:36945243-36945265 CTTAATATGTATCTTGTGCCAGG - Intergenic
1149663117 17:58346422-58346444 CTACTTATCAATCGTCTGCTTGG + Intronic
1153651632 18:7246279-7246301 CATTTTATCAATCGAATGCCAGG + Intergenic
1156213756 18:34976581-34976603 CTTATCATCAATCGTGCTCCAGG + Intergenic
929726368 2:44432270-44432292 CTTATTATTACCCGTGTGCAGGG - Intronic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
943059118 2:183019683-183019705 CTTGTTATCTAATGTGTGCCAGG - Intronic
944136929 2:196409919-196409941 CTTTTTATGATTCTTGTGCCAGG - Intronic
948351210 2:237342635-237342657 ATAATTACTAATCGTGTGCCAGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1171344577 20:24456368-24456390 CTTATTAACAAGAGTGTGCATGG - Intergenic
1172340729 20:34155434-34155456 CTTGTTATCAGTGGTGTGCAAGG + Intergenic
1175001062 20:55631098-55631120 CTTTTTTTCAGTGGTGTGCCAGG + Intergenic
952879360 3:37973738-37973760 CTTAGTACCTATTGTGTGCCAGG + Intronic
953262943 3:41357862-41357884 CTTAGCATCTATCGTGTGCTGGG + Intronic
957448091 3:80340269-80340291 CTTTCTATCAATTGTGTGCGTGG - Intergenic
970849516 4:20584462-20584484 GTAATTGTCAATAGTGTGCCTGG - Intronic
972808845 4:42561174-42561196 CTTTTTATCCAGCGTGTGCACGG + Intronic
973969571 4:56198596-56198618 TTTATTATCTACTGTGTGCCAGG + Intronic
974619008 4:64331515-64331537 CTTATTATTTATCATGTCCCTGG - Intronic
978770691 4:112453244-112453266 CTTATTAACAACCAAGTGCCAGG - Intergenic
991730866 5:69586765-69586787 CTTATTTTCAGTAGTGTGCTAGG - Intronic
991807302 5:70441927-70441949 CTTATTTTCAGTAGTGTGCTAGG - Intergenic
991864084 5:71041091-71041113 CTTATTTTCAGTAGTGTGCTAGG + Intronic
994023944 5:95060347-95060369 CTGATTTTCAAAAGTGTGCCGGG - Intronic
998337727 5:141388326-141388348 CCTAATATAAATCGTGTGCCAGG - Exonic
998596638 5:143537056-143537078 TTTATTATCTATTGTATGCCAGG + Intergenic
1008217816 6:48816678-48816700 ATTATTATTAATAGTGTGGCTGG - Intergenic
1014089165 6:117383920-117383942 ATGATTATCAATAATGTGCCAGG + Intronic
1014633537 6:123816706-123816728 CTTATTCTCAAATGTTTGCCTGG - Intronic
1016375556 6:143417061-143417083 TTTATTGACTATCGTGTGCCAGG - Intergenic
1018638957 6:165889580-165889602 CTCATTTTCTAACGTGTGCCTGG - Intronic
1021803436 7:24331236-24331258 CTGAATATCAACCGTGTGGCAGG + Intergenic
1022155482 7:27657925-27657947 CTTATTATCAATCGTGTGCCAGG - Intronic
1024960856 7:54974208-54974230 CTTAAAATCAATAATGTGCCAGG + Intergenic
1030508095 7:110450099-110450121 CTTATTATTTATCATATGCCAGG - Intergenic
1033107279 7:138539082-138539104 CTGATTATCTATAGTGTGCCAGG + Intronic
1038227722 8:25672299-25672321 CTGATTATTTACCGTGTGCCAGG + Intergenic
1042934965 8:74049177-74049199 CTTACCATCTATCCTGTGCCTGG + Intergenic
1046722225 8:117633404-117633426 CTTACTACCCATCCTGTGCCAGG + Intergenic
1048815290 8:138328028-138328050 CTTATTATCATTCTTGTCTCGGG + Intronic
1057761917 9:97882062-97882084 CTTATTGTCAATACTGTGCATGG + Intergenic
1058843032 9:108929061-108929083 TTTATTAACTATCATGTGCCTGG - Intronic
1190876856 X:54466141-54466163 CTGATTATCAACTGTGTGCTGGG + Intronic
1195284297 X:103368305-103368327 TTTATTATCTATCATGTGCTAGG - Intergenic
1198378410 X:136061736-136061758 CTTAAAATTACTCGTGTGCCAGG + Intergenic
1201189096 Y:11430919-11430941 CTGATCATCTACCGTGTGCCAGG - Intergenic