ID: 1022156910

View in Genome Browser
Species Human (GRCh38)
Location 7:27669848-27669870
Sequence CACCTCCCAATACTGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022156903_1022156910 0 Left 1022156903 7:27669825-27669847 CCTAAACACCTCCCAGAAGGCCC No data
Right 1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG No data
1022156901_1022156910 8 Left 1022156901 7:27669817-27669839 CCTCATGACCTAAACACCTCCCA 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
Right 1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG No data
1022156899_1022156910 28 Left 1022156899 7:27669797-27669819 CCTTTTTATAGTGGCAGAGCCCT No data
Right 1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG No data
1022156900_1022156910 9 Left 1022156900 7:27669816-27669838 CCCTCATGACCTAAACACCTCCC 0: 51
1: 536
2: 1995
3: 4419
4: 7815
Right 1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG No data
1022156904_1022156910 -8 Left 1022156904 7:27669833-27669855 CCTCCCAGAAGGCCCCACCTCCC No data
Right 1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022156910 Original CRISPR CACCTCCCAATACTGTTGCA TGG Intergenic
No off target data available for this crispr