ID: 1022158141

View in Genome Browser
Species Human (GRCh38)
Location 7:27680837-27680859
Sequence GGGCCACTGGGGCCCTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022158133_1022158141 13 Left 1022158133 7:27680801-27680823 CCAGGTCTTTCTGCTGTGCCAGG No data
Right 1022158141 7:27680837-27680859 GGGCCACTGGGGCCCTTTCAAGG No data
1022158132_1022158141 20 Left 1022158132 7:27680794-27680816 CCTAGGTCCAGGTCTTTCTGCTG No data
Right 1022158141 7:27680837-27680859 GGGCCACTGGGGCCCTTTCAAGG No data
1022158137_1022158141 -5 Left 1022158137 7:27680819-27680841 CCAGGATGCAATCTGAGAGGGCC No data
Right 1022158141 7:27680837-27680859 GGGCCACTGGGGCCCTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022158141 Original CRISPR GGGCCACTGGGGCCCTTTCA AGG Intergenic