ID: 1022158142

View in Genome Browser
Species Human (GRCh38)
Location 7:27680840-27680862
Sequence TTTCCTTGAAAGGGCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022158142_1022158146 -4 Left 1022158142 7:27680840-27680862 CCACTGGGGCCCTTTCAAGGAAA No data
Right 1022158146 7:27680859-27680881 GAAACTAATTTGACTCATTAGGG No data
1022158142_1022158147 6 Left 1022158142 7:27680840-27680862 CCACTGGGGCCCTTTCAAGGAAA No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data
1022158142_1022158145 -5 Left 1022158142 7:27680840-27680862 CCACTGGGGCCCTTTCAAGGAAA No data
Right 1022158145 7:27680858-27680880 GGAAACTAATTTGACTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022158142 Original CRISPR TTTCCTTGAAAGGGCCCCAG TGG (reversed) Intergenic