ID: 1022158143

View in Genome Browser
Species Human (GRCh38)
Location 7:27680849-27680871
Sequence TCAAATTAGTTTCCTTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022158143_1022158147 -3 Left 1022158143 7:27680849-27680871 CCCTTTCAAGGAAACTAATTTGA No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022158143 Original CRISPR TCAAATTAGTTTCCTTGAAA GGG (reversed) Intergenic