ID: 1022158144

View in Genome Browser
Species Human (GRCh38)
Location 7:27680850-27680872
Sequence GTCAAATTAGTTTCCTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022158144_1022158147 -4 Left 1022158144 7:27680850-27680872 CCTTTCAAGGAAACTAATTTGAC No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022158144 Original CRISPR GTCAAATTAGTTTCCTTGAA AGG (reversed) Intergenic