ID: 1022158146 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:27680859-27680881 |
Sequence | GAAACTAATTTGACTCATTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022158137_1022158146 | 17 | Left | 1022158137 | 7:27680819-27680841 | CCAGGATGCAATCTGAGAGGGCC | No data | ||
Right | 1022158146 | 7:27680859-27680881 | GAAACTAATTTGACTCATTAGGG | No data | ||||
1022158142_1022158146 | -4 | Left | 1022158142 | 7:27680840-27680862 | CCACTGGGGCCCTTTCAAGGAAA | No data | ||
Right | 1022158146 | 7:27680859-27680881 | GAAACTAATTTGACTCATTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022158146 | Original CRISPR | GAAACTAATTTGACTCATTA GGG | Intergenic | ||