ID: 1022158146 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:27680859-27680881 |
| Sequence | GAAACTAATTTGACTCATTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022158142_1022158146 | -4 | Left | 1022158142 | 7:27680840-27680862 | CCACTGGGGCCCTTTCAAGGAAA | No data | ||
| Right | 1022158146 | 7:27680859-27680881 | GAAACTAATTTGACTCATTAGGG | No data | ||||
| 1022158137_1022158146 | 17 | Left | 1022158137 | 7:27680819-27680841 | CCAGGATGCAATCTGAGAGGGCC | No data | ||
| Right | 1022158146 | 7:27680859-27680881 | GAAACTAATTTGACTCATTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022158146 | Original CRISPR | GAAACTAATTTGACTCATTA GGG | Intergenic | ||
| No off target data available for this crispr | |||||