ID: 1022158146

View in Genome Browser
Species Human (GRCh38)
Location 7:27680859-27680881
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022158137_1022158146 17 Left 1022158137 7:27680819-27680841 CCAGGATGCAATCTGAGAGGGCC No data
Right 1022158146 7:27680859-27680881 GAAACTAATTTGACTCATTAGGG No data
1022158142_1022158146 -4 Left 1022158142 7:27680840-27680862 CCACTGGGGCCCTTTCAAGGAAA No data
Right 1022158146 7:27680859-27680881 GAAACTAATTTGACTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022158146 Original CRISPR GAAACTAATTTGACTCATTA GGG Intergenic