ID: 1022158147

View in Genome Browser
Species Human (GRCh38)
Location 7:27680869-27680891
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022158137_1022158147 27 Left 1022158137 7:27680819-27680841 CCAGGATGCAATCTGAGAGGGCC No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data
1022158143_1022158147 -3 Left 1022158143 7:27680849-27680871 CCCTTTCAAGGAAACTAATTTGA No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data
1022158142_1022158147 6 Left 1022158142 7:27680840-27680862 CCACTGGGGCCCTTTCAAGGAAA No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data
1022158144_1022158147 -4 Left 1022158144 7:27680850-27680872 CCTTTCAAGGAAACTAATTTGAC No data
Right 1022158147 7:27680869-27680891 TGACTCATTAGGGACTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022158147 Original CRISPR TGACTCATTAGGGACTCTAA TGG Intergenic