ID: 1022160971

View in Genome Browser
Species Human (GRCh38)
Location 7:27710818-27710840
Sequence CTTTCGGAGGCGAGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022160962_1022160971 0 Left 1022160962 7:27710795-27710817 CCTCAATGCCTATAATCCCAGCA No data
Right 1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG No data
1022160964_1022160971 -8 Left 1022160964 7:27710803-27710825 CCTATAATCCCAGCACTTTCGGA 0: 217
1: 30867
2: 329096
3: 253418
4: 134447
Right 1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG No data
1022160961_1022160971 12 Left 1022160961 7:27710783-27710805 CCAGGCATGGTGCCTCAATGCCT No data
Right 1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022160971 Original CRISPR CTTTCGGAGGCGAGGATGGG AGG Intergenic
No off target data available for this crispr