ID: 1022163289

View in Genome Browser
Species Human (GRCh38)
Location 7:27733114-27733136
Sequence AAATCCTGACAAAACCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022163289_1022163294 20 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163294 7:27733157-27733179 AGATAGGGTACGGGATATTTTGG No data
1022163289_1022163290 4 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163290 7:27733141-27733163 ATATTGCTCTGTACTAAGATAGG No data
1022163289_1022163295 28 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163295 7:27733165-27733187 TACGGGATATTTTGGAGACCAGG No data
1022163289_1022163291 5 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163291 7:27733142-27733164 TATTGCTCTGTACTAAGATAGGG No data
1022163289_1022163293 11 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163293 7:27733148-27733170 TCTGTACTAAGATAGGGTACGGG No data
1022163289_1022163292 10 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163292 7:27733147-27733169 CTCTGTACTAAGATAGGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022163289 Original CRISPR AAATCCTGACAAAACCAGAA TGG (reversed) Intergenic
No off target data available for this crispr