ID: 1022163291

View in Genome Browser
Species Human (GRCh38)
Location 7:27733142-27733164
Sequence TATTGCTCTGTACTAAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022163289_1022163291 5 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163291 7:27733142-27733164 TATTGCTCTGTACTAAGATAGGG No data
1022163286_1022163291 30 Left 1022163286 7:27733089-27733111 CCAATTCAATTTCTGTTTTGAGT No data
Right 1022163291 7:27733142-27733164 TATTGCTCTGTACTAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022163291 Original CRISPR TATTGCTCTGTACTAAGATA GGG Intergenic
No off target data available for this crispr