ID: 1022163293

View in Genome Browser
Species Human (GRCh38)
Location 7:27733148-27733170
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022163289_1022163293 11 Left 1022163289 7:27733114-27733136 CCATTCTGGTTTTGTCAGGATTT No data
Right 1022163293 7:27733148-27733170 TCTGTACTAAGATAGGGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022163293 Original CRISPR TCTGTACTAAGATAGGGTAC GGG Intergenic
No off target data available for this crispr