ID: 1022165028

View in Genome Browser
Species Human (GRCh38)
Location 7:27750466-27750488
Sequence CTGTATAAGCAGAGGCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022165023_1022165028 23 Left 1022165023 7:27750420-27750442 CCAAAGCACTTCTGGTCTCAAGC 0: 2
1: 31
2: 224
3: 332
4: 534
Right 1022165028 7:27750466-27750488 CTGTATAAGCAGAGGCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022165028 Original CRISPR CTGTATAAGCAGAGGCTTAG AGG Intronic
No off target data available for this crispr