ID: 1022171500

View in Genome Browser
Species Human (GRCh38)
Location 7:27836341-27836363
Sequence CTGTCCCCTCTGATGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022171497_1022171500 -9 Left 1022171497 7:27836327-27836349 CCATTAGGAACTACCTGTCCCCT 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG No data
1022171496_1022171500 -6 Left 1022171496 7:27836324-27836346 CCACCATTAGGAACTACCTGTCC 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022171500 Original CRISPR CTGTCCCCTCTGATGGAATT AGG Intronic
No off target data available for this crispr