ID: 1022171635

View in Genome Browser
Species Human (GRCh38)
Location 7:27837421-27837443
Sequence CCACATTTCCCCGTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022171626_1022171635 8 Left 1022171626 7:27837390-27837412 CCTCCCATGGCTTTGGGGCTCAG 0: 1
1: 1
2: 0
3: 14
4: 226
Right 1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1022171627_1022171635 5 Left 1022171627 7:27837393-27837415 CCCATGGCTTTGGGGCTCAGTGG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1022171629_1022171635 4 Left 1022171629 7:27837394-27837416 CCATGGCTTTGGGGCTCAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 270
Right 1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG 0: 1
1: 0
2: 1
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022171635 Original CRISPR CCACATTTCCCCGTTCCCAT GGG Intronic
902655667 1:17866247-17866269 CATCATTTTCCCCTTCCCATTGG + Intergenic
906329516 1:44873266-44873288 CCTCATTTCCCTCTTCCCAGAGG + Intronic
908086237 1:60637312-60637334 CCACATTTCTCCTTTCACTTTGG + Intergenic
909585452 1:77282809-77282831 CCACATTTCCTCTTTCCCCCAGG - Intronic
912508729 1:110174229-110174251 CCTCATTTCCCCTTCCCCAGTGG + Intronic
916579520 1:166095188-166095210 TTGCATTTCCCCGTTCCCAAAGG + Intronic
919265800 1:195263576-195263598 CCATCATTCCCCTTTCCCATGGG - Intergenic
922109110 1:222540194-222540216 CCACATGTTCCTGATCCCATAGG + Exonic
922989297 1:229892764-229892786 CCTCAAGTCCCAGTTCCCATAGG + Intergenic
923912440 1:238463571-238463593 CCATATTTCTCCTTTCCCTTTGG + Intergenic
1066388412 10:34959982-34960004 CCTCACTTCCCCTTTCCCAAGGG - Intergenic
1067145535 10:43691008-43691030 CCACATTTCCCCCTTCCCCCAGG + Intergenic
1073687483 10:105771170-105771192 ACACATTTCCCCCTTCTCTTGGG + Intergenic
1075857173 10:125639582-125639604 CCACATTGCCCCATTCCCTTTGG - Intronic
1076050283 10:127328046-127328068 CCACATTTTCCCATTCTCACTGG - Intronic
1076257142 10:129036608-129036630 CCTCATTTGCCCTTTCCAATGGG - Intergenic
1081944807 11:46981817-46981839 CCTCATTTCCCCATTCCCTTTGG + Intronic
1084779853 11:71400890-71400912 CCACATTTTCTCCTTCCTATGGG - Intergenic
1085069498 11:73530309-73530331 CTACATTTCTCCTTTCCCAGTGG + Intronic
1085232292 11:74982658-74982680 GCAGATTTCCCTGTCCCCATGGG - Intergenic
1086931709 11:92700465-92700487 CCACATTTCCCTGCTGCCACTGG - Intronic
1087938245 11:104061000-104061022 CCCCATTTCCTCCTTCCCACAGG + Intronic
1089744840 11:120609432-120609454 CCCCCTTTCCCCTTTCCCAAAGG + Intronic
1092749454 12:11705035-11705057 CCACATCTCCCCATTTCCACCGG - Intronic
1100631949 12:96399294-96399316 CCCCATTTTCCCCTCCCCATCGG + Intronic
1104390329 12:128386430-128386452 CCACATTTTCCCTTTCCGTTGGG + Intronic
1106328394 13:28716683-28716705 ACTCATTTCCTCATTCCCATGGG - Intronic
1107005403 13:35604261-35604283 CTCCATTTCCCCGTTCATATTGG + Intronic
1116277980 14:42861349-42861371 TCACATTTCCCTGTTCACAGAGG + Intergenic
1116484225 14:45427643-45427665 CCTCTTTTCCCTGGTCCCATGGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1119630210 14:76224225-76224247 CCCCATTCCCCTTTTCCCATTGG - Intronic
1121872011 14:97416838-97416860 CCACATTTCCCCATTGTCAAAGG + Intergenic
1124399722 15:29337599-29337621 CCACATTTCCACATTCCCTGTGG + Intronic
1128456089 15:67832254-67832276 CCACTTTTCCCCTTTCACAGAGG + Exonic
1131149288 15:90036868-90036890 CCACTGTTCCCAGTTCACATCGG + Intronic
1138049202 16:53758722-53758744 CCACATTTTCCTGTTCCTCTGGG - Intronic
1138481367 16:57305493-57305515 CCAGATTCCCCCATTCCCCTGGG - Intergenic
1140953248 16:79839170-79839192 ACACATTTCCCTGCTCCCTTTGG + Intergenic
1144442926 17:15300269-15300291 CCAAATTTCCCAGTTCCCTAAGG - Intergenic
1145102909 17:20091558-20091580 GCACATTGCCACGTGCCCATTGG + Intronic
1148145522 17:45362175-45362197 CCACATTTCCCAGGCCCCCTTGG - Intergenic
1149548252 17:57520321-57520343 CCACATCTTTCAGTTCCCATGGG + Intronic
1151472456 17:74326622-74326644 CCACCTTTCCACCCTCCCATTGG + Intronic
1152465631 17:80464599-80464621 CAACATTTCCCAGCTCCCCTTGG + Intergenic
1158191143 18:54830108-54830130 CCACAGTTCCCCTTTCTCATAGG + Intronic
1159123111 18:64192833-64192855 CCCCATTTCTCCTTTGCCATTGG - Intergenic
1161319667 19:3635076-3635098 CCACATTTTCAAGTCCCCATGGG - Intronic
1163069419 19:14826195-14826217 TCACAATTCCCCATTCCCAGAGG + Intronic
1163376815 19:16938255-16938277 CCACAGTGCCCCCTTCCCAGGGG + Intronic
1165725805 19:38111751-38111773 CCACCTCTCCCCCTGCCCATCGG + Intronic
1166539315 19:43595063-43595085 CAACGGTTCCCCGTTCCCCTCGG + Exonic
1168543596 19:57232070-57232092 CCAAATTTCCCCTTGCCCAGGGG - Exonic
925562942 2:5217930-5217952 CCACAATTCCCACATCCCATGGG + Intergenic
928326322 2:30322546-30322568 CCACATTTGTCCCTTCCCCTGGG + Intronic
929360116 2:41077894-41077916 CTACATCTCCTCATTCCCATTGG + Intergenic
932056599 2:68449337-68449359 CCACACTTTCCCATTCCCCTCGG + Intergenic
934097525 2:88620284-88620306 CCACACTCCCCCCTTTCCATGGG + Intronic
935657704 2:105438894-105438916 CCACATTTCCCAGCTCACAGAGG - Intergenic
941007998 2:160267086-160267108 CCACATTTGGCCCTTCACATGGG - Intronic
942241934 2:173970929-173970951 CCACATTTCCAAGTTCCTAATGG - Intergenic
944495098 2:200299171-200299193 CCAAATTTCCCCCTTTTCATAGG - Intergenic
945168183 2:206968140-206968162 CCACCTTTCCAACTTCCCATCGG - Intronic
947759028 2:232589801-232589823 CCAAATTTCCCTGGTCCCATTGG - Intergenic
948530482 2:238600506-238600528 CCACGTTTCCCCGAGTCCATCGG + Intergenic
1169315059 20:4583640-4583662 ACACATTTCCCTGTTCCCTAAGG - Intergenic
1172996235 20:39072274-39072296 CCCCATTTCTCCGATCCCAAGGG - Intergenic
1177840155 21:26227077-26227099 CCACATTTCACTGTTTCCATGGG - Intergenic
1178894701 21:36548828-36548850 AGACATTTCCCCTTTCTCATGGG - Intronic
1179966542 21:44810092-44810114 CCACATTTCTCCATTCCCTCAGG - Intronic
1182029219 22:27144375-27144397 CCACATTTCCCCTTTCTAAAAGG - Intergenic
1184147676 22:42620812-42620834 CCACATTTCCCTTTTCACCTTGG + Intronic
1184225898 22:43128744-43128766 CCACATCTGCCTGATCCCATGGG + Intronic
1184982159 22:48102479-48102501 CCACAATTCCCACTTGCCATGGG - Intergenic
953245759 3:41190280-41190302 CCACATGGCCCCATTCCCAAAGG + Intergenic
954425823 3:50442641-50442663 CCACATATCCCAGGGCCCATGGG + Intronic
955464210 3:59219449-59219471 CCCCATTTCCCCCTTACCCTGGG + Intergenic
956355768 3:68390399-68390421 CCACAGCTGCCCCTTCCCATAGG - Intronic
956733299 3:72216521-72216543 CCACAATCCCCAATTCCCATAGG + Intergenic
960666180 3:120111184-120111206 CCACTTTTCCCCACTCCAATTGG - Intergenic
960878902 3:122325232-122325254 CCACACTTCCCTGTTCACTTTGG + Exonic
962993451 3:140601571-140601593 CCCCATTTCCCAGTTCCCTGTGG + Intergenic
966920398 3:184607458-184607480 CCGCACTTCCCCCGTCCCATAGG + Intronic
967877398 3:194276595-194276617 CTCCACTTCCCCGTTCCCAAGGG - Intergenic
968288861 3:197523818-197523840 CCACAGTGCCCCGTCCCCATCGG - Intronic
968743377 4:2342838-2342860 CCACTTCTCTCCTTTCCCATTGG - Intronic
969843040 4:9897578-9897600 CCACACTTTCCCTTTTCCATTGG - Intronic
973123895 4:46559263-46559285 CCACATTTCCCACTTCACAGAGG - Intergenic
974016755 4:56655662-56655684 CCCCGCTTCCCCGCTCCCATGGG - Intronic
976160486 4:82193202-82193224 TACCATTTCCCCTTTCCCATAGG - Intergenic
979539947 4:121870076-121870098 CCGCTTTTCCCCGGTCCCCTCGG + Intronic
983598050 4:169492854-169492876 CCACATTTCCTGTTTCCCATTGG - Intronic
984379245 4:178969221-178969243 CGACATTTCCTCCTTCCCCTAGG - Intergenic
986120543 5:4831767-4831789 CCACTTTTCCCCATGTCCATAGG + Intergenic
988180573 5:27786455-27786477 CCAGACTTCCCCTATCCCATTGG - Intergenic
993453581 5:88101542-88101564 CCACTCTTCCCTGTTACCATTGG + Intergenic
995097533 5:108256471-108256493 CCCTATTTCCCCCTTCCCAGAGG + Intronic
998224980 5:140320023-140320045 ACACATTTCCTCTTTCTCATGGG + Intergenic
999841293 5:155430518-155430540 CCACAATTCCCACTTGCCATGGG + Intergenic
1001691030 5:173632631-173632653 CCCTAATTCCCTGTTCCCATGGG + Intergenic
1002315857 5:178342546-178342568 CCCCATTTCCCAGGTCCCACCGG + Intronic
1002999965 6:2322572-2322594 CAACATTTCCCCGATACCAAAGG - Intergenic
1004211266 6:13648026-13648048 TCCCATTTCCCCGTTCCCCCTGG + Intronic
1005983734 6:30857051-30857073 CCCCATTTGCACATTCCCATAGG - Intergenic
1011830542 6:91365908-91365930 CCACATTTCCCAGTTTCCCATGG - Intergenic
1012065592 6:94546310-94546332 GCACATTTCCCCTTTCCAAGTGG - Intergenic
1014869591 6:126576488-126576510 CTTTATTTCCCCATTCCCATGGG + Intergenic
1015174204 6:130288615-130288637 CCACATTTCTCCTTTTACATTGG - Intronic
1015433590 6:133159332-133159354 CCAGATTTCCCCTTTCTCTTTGG + Intergenic
1018094942 6:160377182-160377204 CCACATTTCCCTGTTTCAACTGG - Intronic
1019906691 7:4070281-4070303 CCTCATTTCCCGGTTCACTTTGG + Intronic
1021252166 7:18343252-18343274 ACACATTTCACCGTTCCCTAAGG + Intronic
1021963363 7:25894379-25894401 CTACATTTCCCAGCTCCCCTTGG + Intergenic
1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG + Intronic
1023140394 7:37096396-37096418 GCAAATTTCTCCATTCCCATAGG + Intronic
1023869470 7:44255325-44255347 CCACATTACCCGGCTCCCAGAGG - Intronic
1026958584 7:74394112-74394134 CCACATTTCCTCTTTCCCAGAGG + Intronic
1027260105 7:76458756-76458778 CCTCATTTCCAGGTTCCCAGGGG + Intergenic
1027311480 7:76956860-76956882 CCTCATTTCCAGGTTCCCAGGGG + Intergenic
1031030316 7:116727315-116727337 TCACAGTGCCCAGTTCCCATTGG - Intronic
1034382953 7:150714987-150715009 CCACATTTCCACTTTCCTACTGG - Intergenic
1036781460 8:11650743-11650765 CCACATTTCCCCGGAGCCGTGGG + Intergenic
1038919936 8:32071605-32071627 CCACATTTCCACGGTCATATTGG - Intronic
1040111821 8:43570115-43570137 CCACCTTTCCCCATCCCCAGGGG + Intergenic
1040112376 8:43572202-43572224 CCACCTGTCCCCGTTCCCTGGGG + Intergenic
1047926814 8:129690265-129690287 CCACATTTCAGCCTTCCCCTTGG - Intergenic
1049532382 8:143160777-143160799 CCCCGTTTCCCCGTTTCCAGTGG + Intergenic
1051157024 9:14159488-14159510 TCACCTGTCCCTGTTCCCATAGG - Intronic
1051552846 9:18349678-18349700 ACACATTTACCCATTTCCATCGG + Intergenic
1053280710 9:36818374-36818396 CCCCATTACCCCGTTCCTGTTGG - Intergenic
1054793379 9:69276490-69276512 CCACATTTCCACATTCCTAAGGG + Intergenic
1055476377 9:76667291-76667313 CTACTTTTCCCCCTTCCCTTCGG - Intronic
1058035547 9:100248741-100248763 TCACATTTCCCCTTTGCCACAGG + Intronic
1060149238 9:121277070-121277092 ACACATTTTCCTGTTCCCCTAGG + Intronic
1061316566 9:129799921-129799943 TCTCATTTCCCCTTTCCCATTGG + Intergenic
1061449537 9:130660847-130660869 CCACACGCCCCCGTTCTCATAGG + Intergenic
1062407753 9:136404978-136405000 CCACATGGCCCCGCTCCCAAGGG + Intronic
1185833834 X:3327113-3327135 CTACTTCTGCCCGTTCCCATTGG + Intronic
1186057935 X:5671342-5671364 CCACATTTCCCCAAGCCCCTGGG + Intergenic
1188898418 X:35698322-35698344 CCACTTTTTCCAGTTCCCAATGG + Intergenic
1189714798 X:43854163-43854185 CCCCATTTCCCAGTTCCAACAGG - Intronic
1191798330 X:65048073-65048095 CCACATTTCCCCGTTTCCCTGGG + Intergenic
1192639155 X:72846525-72846547 CCATATTGCCCAGTCCCCATGGG - Intronic
1192642556 X:72874280-72874302 CCATATTGCCCAGTCCCCATGGG + Intronic
1193098106 X:77576768-77576790 CCCCATTTCCCCTTACCCACAGG + Intronic
1195969826 X:110461143-110461165 CCACATTTCCCCTTTCCTGAGGG - Intergenic
1198454841 X:136806252-136806274 CCTCATTTCCCAGTTCCTGTGGG - Intergenic