ID: 1022172057

View in Genome Browser
Species Human (GRCh38)
Location 7:27840311-27840333
Sequence CCAACGGATGGCCCTACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022172057_1022172063 -10 Left 1022172057 7:27840311-27840333 CCATCTGTAGGGCCATCCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1022172063 7:27840324-27840346 CATCCGTTGGGGAAGGTGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 133
1022172057_1022172065 3 Left 1022172057 7:27840311-27840333 CCATCTGTAGGGCCATCCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1022172065 7:27840337-27840359 AGGTGCTTGGCAAATAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022172057 Original CRISPR CCAACGGATGGCCCTACAGA TGG (reversed) Intronic
904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG + Intergenic
922701823 1:227765775-227765797 CACAGGGATGGCCCTAAAGAGGG - Intronic
1065493764 10:26308450-26308472 CCATCGGACGGCTCCACAGATGG + Intergenic
1065774569 10:29107452-29107474 CCAACAGCTGGCCTTAGAGAGGG - Intergenic
1089457101 11:118632091-118632113 CCAACTGAAGGCCCCAGAGAGGG + Intronic
1091139691 11:133224315-133224337 CCCAGGGATGCCCCTGCAGATGG + Intronic
1102555957 12:113726533-113726555 CCAAGGTTTTGCCCTACAGAAGG + Intergenic
1105446604 13:20462276-20462298 CCAGGGGATGGCAGTACAGATGG + Intronic
1112017735 13:95345362-95345384 CACACGGATGGCCATCCAGATGG + Intergenic
1119967699 14:78935365-78935387 CCAAGGGATGGCTCTATACATGG - Intronic
1122922410 14:104885473-104885495 CCAGCGGATGGCGCTACTGCAGG + Exonic
1128937185 15:71756835-71756857 CCAACGTATGGCAAGACAGATGG + Intronic
1130270509 15:82443938-82443960 CCAGCCTCTGGCCCTACAGATGG - Intergenic
1130462853 15:84171257-84171279 CCAGCCTCTGGCCCTACAGATGG - Intergenic
1130489821 15:84423530-84423552 CCAGCCTCTGGCCCTACAGATGG + Intergenic
1130501412 15:84502280-84502302 CCAGCCTCTGGCCCTACAGATGG + Intergenic
1140659195 16:77170979-77171001 CCACCCCATGGCACTACAGAGGG + Intergenic
1145998190 17:29116309-29116331 CCCACTGATGGCCCAACAGTGGG + Intronic
1155439015 18:25842097-25842119 CCATCTAATGGCCCTAGAGAGGG + Intergenic
1161681666 19:5682700-5682722 CCTAGGGCTGGACCTACAGATGG + Intronic
1166160268 19:40947586-40947608 CAAACAGATGGCCCCAGAGATGG + Intergenic
925899104 2:8495761-8495783 CCAACGGCTGGCATTACAGCAGG + Intergenic
928202178 2:29254960-29254982 CAGACGGATGGGCCTAGAGAGGG + Intronic
935282799 2:101533728-101533750 CCACCGGCCGGCCCTACAGCTGG - Intergenic
937467610 2:122148459-122148481 CAAATGGATGACCCCACAGATGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1174192106 20:48747928-48747950 CCCATGGACGGCCCTACAGAAGG + Intronic
1183380925 22:37490149-37490171 CCAGAGGAGGGCCCCACAGATGG - Intergenic
1184870876 22:47237849-47237871 CCAAAGGATGTCCCTCCACATGG - Intergenic
1185345439 22:50308584-50308606 CCAAGGTCTGGCCCTGCAGACGG - Intergenic
950656991 3:14442760-14442782 CCAACGGGAGGCCCCAGAGAAGG - Intronic
953125215 3:40086387-40086409 CCAAAGGAAGCCTCTACAGAGGG - Intronic
959635728 3:108566406-108566428 CCAAAGGATGGTCCTCCAAAAGG + Intronic
960094652 3:113677622-113677644 CCAACGGATGGTCCCCAAGAGGG + Intronic
963958310 3:151280115-151280137 CAAAAGGATAGCCCTACAGGTGG + Intronic
965612298 3:170557247-170557269 CCAAAGGATGGCCTTACGAATGG - Intronic
968507803 4:979796-979818 CCAACAGGTGGACCTGCAGAGGG - Intronic
969058994 4:4420313-4420335 CCAAATGATGGCCAAACAGAGGG - Intronic
985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG + Intergenic
994029863 5:95129492-95129514 CTAACGGATGCCCAAACAGATGG + Intronic
997843437 5:137263499-137263521 CCCCCGGATGGACCTTCAGAGGG - Intronic
1008778368 6:55069347-55069369 CCAGCAGATGGCAGTACAGATGG - Intergenic
1016882102 6:148921594-148921616 CCAAAGGATGGCTCCAGAGAGGG - Intronic
1021919068 7:25465535-25465557 CCAAAGGAGGGCCGTCCAGAAGG + Intergenic
1022172057 7:27840311-27840333 CCAACGGATGGCCCTACAGATGG - Intronic
1033363830 7:140656532-140656554 CCAACCGAAGGAACTACAGACGG + Intronic
1035168832 7:157006736-157006758 CCAAGGCCTGGCCCTGCAGAGGG + Intronic
1050268693 9:3918709-3918731 CCTAGGGATGGCCCTGTAGAGGG - Intronic
1060736715 9:126070879-126070901 CCAAGGGAGGGCCCTGCGGAAGG - Intergenic