ID: 1022176448

View in Genome Browser
Species Human (GRCh38)
Location 7:27875834-27875856
Sequence CTAGTTTTCCAGGTATAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022176448_1022176453 14 Left 1022176448 7:27875834-27875856 CCTAGTTATACCTGGAAAACTAG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1022176453 7:27875871-27875893 GCTAAAATGAATGTTATGGAAGG 0: 1
1: 0
2: 1
3: 32
4: 302
1022176448_1022176450 -10 Left 1022176448 7:27875834-27875856 CCTAGTTATACCTGGAAAACTAG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1022176450 7:27875847-27875869 GGAAAACTAGTAATTATCCTAGG No data
1022176448_1022176452 10 Left 1022176448 7:27875834-27875856 CCTAGTTATACCTGGAAAACTAG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1022176452 7:27875867-27875889 AGGAGCTAAAATGAATGTTATGG 0: 1
1: 0
2: 2
3: 23
4: 228
1022176448_1022176454 25 Left 1022176448 7:27875834-27875856 CCTAGTTATACCTGGAAAACTAG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1022176454 7:27875882-27875904 TGTTATGGAAGGACACACAAAGG 0: 1
1: 0
2: 1
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022176448 Original CRISPR CTAGTTTTCCAGGTATAACT AGG (reversed) Intronic
904372055 1:30054703-30054725 CTAGATTCCCAGGAATACCTTGG - Intergenic
905921481 1:41722336-41722358 CTAGTTTTCCACATATATCAGGG + Intronic
906365207 1:45204632-45204654 CTAGCTCTCCAGGTAAAACCTGG - Intronic
908095191 1:60730165-60730187 CTAGTTTTCCAGATTTACTTTGG - Intergenic
910874893 1:91869167-91869189 CTAGGTGTCCAAGTTTAACTTGG - Intronic
911632626 1:100200020-100200042 CTGGTGTTCCAGGCATCACTGGG - Intronic
912388604 1:109285807-109285829 CTAGTTTTCCAGGTTAAATCTGG - Intergenic
913009575 1:114670018-114670040 CTAGTCTCCCGGGTATCACTCGG + Exonic
913344925 1:117798773-117798795 CTTATATTCCAGGCATAACTTGG + Intergenic
916951135 1:169781504-169781526 CTAGTTTTTCAGGTTTACTTTGG - Intronic
918773883 1:188603186-188603208 CTAGTTTTCCCTGAATAAATCGG + Intergenic
918780413 1:188692739-188692761 CTGGTTTTCCTTCTATAACTTGG + Intergenic
919574984 1:199296823-199296845 CTTGTTTTCCAGATATTACCTGG - Intergenic
920795284 1:209131047-209131069 CTAGTTTTCCAGGTTTCCTTGGG - Intergenic
921626153 1:217379785-217379807 CTGGCATTCCAGGTATCACTGGG - Intergenic
921736810 1:218637814-218637836 CAAGATATCCAGGTACAACTGGG + Intergenic
922237137 1:223730746-223730768 CTTGTTTTTCAGGTTTACCTTGG + Intronic
923076004 1:230609102-230609124 CTAGTTTTTCAGGTTTTATTGGG + Intergenic
924743515 1:246812134-246812156 CTTGATCTCCAGGCATAACTTGG - Intergenic
1063863019 10:10332857-10332879 CTATTTTTGCATATATAACTAGG - Intergenic
1064184825 10:13152479-13152501 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1066192888 10:33071978-33072000 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1066579844 10:36868301-36868323 CTAGTTTTCCAGGAATAGAAGGG - Intergenic
1066585229 10:36926228-36926250 CTAGTTTGACAGGAATAAGTTGG - Intergenic
1068047561 10:51907110-51907132 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1068424152 10:56835377-56835399 ATACATTTCCAGGTATATCTAGG - Intergenic
1068469987 10:57448500-57448522 CTGGTGTTCCAGGTACCACTGGG + Intergenic
1068621576 10:59188905-59188927 CTAGATTTCAAGTTAAAACTAGG - Intronic
1071863026 10:89695470-89695492 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1072191266 10:93078493-93078515 ATAGTTTTTTAGGTAGAACTTGG + Intergenic
1072394718 10:95026802-95026824 CTGGTTTTCCAGGTGCCACTGGG + Intergenic
1075234840 10:120718211-120718233 CTAGTTTTCCAGGTTTAGTTGGG - Intergenic
1077687365 11:4308127-4308149 CTAGTTTTATAGGTAAAACAAGG - Intergenic
1078046540 11:7918300-7918322 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1078533901 11:12157909-12157931 TTAGTTTCCCATGTATAACTAGG - Intronic
1079299930 11:19268938-19268960 CTAGTTTACCAAGTAAAATTTGG - Intergenic
1079696692 11:23490658-23490680 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1080501382 11:32874601-32874623 CTAGATTTCAAGGAATATCTCGG + Intergenic
1080881689 11:36327252-36327274 CTAGTTTTTCAGGTTTACCCTGG - Intronic
1080988810 11:37505555-37505577 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1082903629 11:58283308-58283330 CTAGTGTTCCAGGCACCACTGGG + Intergenic
1084608943 11:70188605-70188627 CTAGCTTTCCAGGGATAACTGGG - Exonic
1087280452 11:96203973-96203995 CTAATTATCCAGGTGTAAATAGG + Intronic
1087445686 11:98249804-98249826 CTAGTTTTGCAGGTATTCTTTGG + Intergenic
1088029639 11:105230928-105230950 CTAGTTCTCTAAATATAACTGGG - Intergenic
1090105478 11:123850628-123850650 CTAGTTCTCCAGCAATAAATTGG - Intergenic
1097316529 12:58177266-58177288 CTTGTTCTTCAGGTAGAACTGGG - Intergenic
1098531229 12:71543890-71543912 TTAGTCTTCCAGGTATCACCAGG - Intronic
1098977344 12:76917031-76917053 CAAGTTTTGCCAGTATAACTAGG + Intergenic
1099053493 12:77809194-77809216 CTGGCTTTCCAGGTGTCACTGGG + Intergenic
1099471976 12:83061484-83061506 CTACTTTTCCATGCAAAACTAGG - Intronic
1100306492 12:93354640-93354662 CTAGTTTTCCAAGAAGAAATTGG + Intergenic
1101713031 12:107286438-107286460 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
1101975884 12:109358445-109358467 CTAATTTTCCAGATAAAACAGGG + Intronic
1103243617 12:119436112-119436134 CTATTTTTCCACCTTTAACTTGG - Intronic
1104680851 12:130750564-130750586 CTAGTTTTTCAGGTTCAATTTGG + Intergenic
1106434509 13:29712018-29712040 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1107655061 13:42584161-42584183 ATAATTTTTGAGGTATAACTTGG + Intronic
1109220971 13:59640522-59640544 CTATTTTTGCAGATATAATTAGG - Intergenic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1111172196 13:84541962-84541984 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1111639923 13:90955103-90955125 CTAGTTTTCCTTCTATAAATAGG + Intergenic
1114805571 14:25832421-25832443 CTAGATTTCCTGGGATTACTTGG - Intergenic
1115244547 14:31281922-31281944 CTAGTGTTCCAGGTATTCCCTGG - Intergenic
1115532714 14:34341978-34342000 CTAGTTTTTCAGGTAAACTTTGG + Intronic
1115691052 14:35844208-35844230 CTGGTGTTCCAGGTACCACTGGG + Intronic
1118105742 14:62657471-62657493 CTAGTTTTTCAGATATATTTAGG - Intergenic
1118158611 14:63266386-63266408 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1118516128 14:66530468-66530490 CTGGTGTTCCAGGTACCACTGGG + Intronic
1119116316 14:72025128-72025150 ATAGTTTTCCAGGTCTACTTAGG - Intronic
1122011780 14:98755924-98755946 ATAGTTTTTCAGCAATAACTGGG - Intergenic
1124122875 15:26906515-26906537 TTAGATTTCCTGGTATAAGTGGG + Intronic
1125341325 15:38678430-38678452 CTAGTTTTTCAGGTTTACTTGGG - Intergenic
1125780282 15:42259670-42259692 CTAGATTTCCAGGAATATTTTGG - Intronic
1126217157 15:46169042-46169064 CCAGTTTTCCAAGCATAATTTGG + Intergenic
1126946027 15:53821516-53821538 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
1129023202 15:72542891-72542913 TCAGTTTTTCAGGTAAAACTTGG + Intronic
1133387103 16:5378562-5378584 CTGCATTCCCAGGTATAACTGGG - Intergenic
1140590539 16:76346755-76346777 CTAGTCTTCCAGGGGAAACTTGG + Intronic
1140782372 16:78308318-78308340 CTAGTTTTTCAGGTTTATTTCGG - Intronic
1141333916 16:83137345-83137367 CTCATTTTCCAGGTAGAACTGGG - Intronic
1141411906 16:83840848-83840870 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1143309935 17:5979670-5979692 CTAGTTTTACAGGCAAAACTTGG + Intronic
1144764876 17:17727152-17727174 CTAGTTTTCCTTGGATAAATGGG + Intronic
1148951849 17:51320234-51320256 CTAGTTTTTCAGGTTTATTTTGG + Intergenic
1154113541 18:11591118-11591140 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1154387799 18:13911305-13911327 CTAGTTTTTAAGGTAAAACAAGG - Intronic
1156872773 18:41966552-41966574 CTTGTTTTCCATGTATAACAGGG - Intronic
1157842843 18:50975526-50975548 CTAGTTGAACAGATATAACTAGG - Intronic
1158381587 18:56936398-56936420 CTAGTTTTCCAGTTAGATGTGGG - Intronic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1166554633 19:43690047-43690069 CTACTGTTCCAGGAATAAGTCGG + Intergenic
924979181 2:205122-205144 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
925236740 2:2285400-2285422 CTAGTTTTCCAAGTGAACCTAGG - Intronic
925487456 2:4351333-4351355 CTATGTATCCAGGTAGAACTGGG - Intergenic
926211622 2:10875058-10875080 CTAGTTTTCCAGCAAGAACCAGG - Intergenic
927144352 2:20152234-20152256 CTTCTTTTGCATGTATAACTAGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929292389 2:40208440-40208462 TTAGTCTTTCAGGTATCACTGGG + Intronic
929302525 2:40322195-40322217 CGAGTTTTCCAGGTATCCCTGGG + Intronic
929884978 2:45870400-45870422 CTTGTTTTAAAGGTATAACTGGG + Intronic
930285447 2:49422334-49422356 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
932653070 2:73581094-73581116 CTAGTTTCCCTGGTATACATGGG + Intronic
936246080 2:110828671-110828693 TCAGTTTCCCAGGTCTAACTTGG - Intronic
937169336 2:119850052-119850074 CTAGTTTACCAGAGATAACCAGG - Intronic
937651805 2:124327416-124327438 CTAGTTTTTCAGGTTGACCTTGG - Intronic
939180984 2:138802606-138802628 ATATTTTTCCATGTATAGCTGGG + Intergenic
941446138 2:165602368-165602390 GTTGTTTTCCAGGCATAAGTGGG - Intronic
941907898 2:170734750-170734772 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
947045748 2:225981279-225981301 CTAGATTTCCAGGGATATATTGG - Intergenic
947618179 2:231571903-231571925 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1169302806 20:4459226-4459248 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1169641554 20:7757838-7757860 ATGGTTTTCAAGGTATACCTTGG - Intergenic
1169795175 20:9454604-9454626 TTAGTTTTCTAGGTATATCTTGG - Intronic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1173117108 20:40255105-40255127 CTAGTGTTCAAGTTCTAACTTGG + Intergenic
1173746558 20:45441868-45441890 CTAGTTTTACAGGTTAACCTTGG - Intergenic
1175173849 20:57097934-57097956 CCAGTTTTAGAGGTATAACCTGG - Intergenic
1179776594 21:43667883-43667905 ATAGTTTTCCATGTAAAACCAGG - Intronic
1183002798 22:34875718-34875740 CCATTTTTCCAGGCATTACTGGG - Intergenic
949226940 3:1705803-1705825 CTGGTTTTCCAGGCCTCACTGGG - Intergenic
950917363 3:16659553-16659575 CTAGTTTTTCAGGTTTACTTTGG - Intronic
952065751 3:29567861-29567883 CTATTTTTACAGGAATAATTTGG - Intronic
952830907 3:37564197-37564219 TTAGTTTTCTATGAATAACTTGG + Intronic
955510894 3:59679371-59679393 CTAGGTTTCCAGGTGTTTCTAGG + Intergenic
955909768 3:63847893-63847915 CTAGTTTTTCAGGTTTACTTTGG - Intronic
956301933 3:67781618-67781640 CTGGTGTTCCAGGCACAACTGGG + Intergenic
957483906 3:80832982-80833004 CTAGTTTTTCAGGTTTAGATGGG - Intergenic
958127511 3:89376429-89376451 CTAATTTTAAAGGTACAACTTGG - Intronic
960323048 3:116261165-116261187 CTAGTTTTACTGTGATAACTAGG - Intronic
960647344 3:119902228-119902250 CTAGTTTTCCTGATTTAAGTTGG - Intronic
960856532 3:122107756-122107778 CTTGTTGTTCAGATATAACTTGG + Intronic
960878956 3:122325943-122325965 CTATTTTTCCATATATAATTTGG - Intronic
961112093 3:124293057-124293079 CTAGTTTCCCAGATATAACAAGG + Intronic
963868101 3:150384812-150384834 CTAATTTCCCAGTTATAACAAGG - Intergenic
964951859 3:162305243-162305265 CTAGTCATCCAAGTATCACTTGG - Intergenic
966121223 3:176522998-176523020 CTAGTTTGGCAGGTAGAGCTGGG + Intergenic
966309376 3:178576461-178576483 CTGGTTTTCCAGGCACCACTGGG - Intronic
967543244 3:190693552-190693574 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
967711136 3:192709673-192709695 TAAGTTTTCCAGTTATAAATTGG + Intronic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
969661796 4:8534386-8534408 CTAGTTTTTCAGGTTTACGTTGG - Intergenic
970068680 4:12129389-12129411 CTATTTTGCCAGGTATACCTGGG + Intergenic
970831212 4:20342073-20342095 CTAGATTTCTTTGTATAACTGGG + Intronic
973930439 4:55788301-55788323 CAATTTTTCCAAATATAACTTGG - Intergenic
973975277 4:56256840-56256862 CTAGTTTTTCAGGTTTACTTTGG - Intronic
974420445 4:61665486-61665508 CTGAATTTCCAGGTATTACTTGG - Intronic
975104088 4:70548716-70548738 CTTGTGTTCCAGGTGTCACTGGG - Intergenic
976167577 4:82271889-82271911 CTAGCATTCCAGGTAACACTGGG - Intergenic
980490778 4:133525216-133525238 GTAGCTTTCAAGGTAAAACTAGG + Intergenic
981089215 4:140715278-140715300 CTAGTTTTTCAGGTTTACTTTGG + Intronic
982113281 4:152075572-152075594 CTTCTCTTCCAAGTATAACTGGG - Intergenic
982589957 4:157295795-157295817 TTAGGTTTCCAGGTAAAAATTGG - Intronic
983499810 4:168486194-168486216 CTAGTTCCCCATGGATAACTAGG - Intronic
986151506 5:5134037-5134059 CTTGTTTTCCCGGTAGTACTGGG - Intergenic
987265831 5:16254068-16254090 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
988866237 5:35338253-35338275 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
989700338 5:44256799-44256821 GTAGTTTTTAAGGTAGAACTTGG - Intergenic
990086568 5:51985978-51986000 CTTGTTCTCCAGGTATCACATGG - Intergenic
991465304 5:66906280-66906302 CTAGTTTTTCAGGTTTACTTTGG + Intronic
992110490 5:73488081-73488103 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
992306922 5:75450215-75450237 CTAGTTTTTCAGGTTTAGTTGGG - Intronic
992908678 5:81373487-81373509 CTGGTGTTCCAGGTACCACTGGG - Intronic
994859242 5:105167270-105167292 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
995454123 5:112333992-112334014 CTAGTTTTTCAGGTTTCACTGGG - Intronic
995477308 5:112561270-112561292 CTAGTTTTTCAGGTTTAGTTGGG - Intergenic
996239903 5:121184805-121184827 CTATTTTTCCAGTTTTATCTTGG + Intergenic
997252253 5:132398245-132398267 CTGGTGTTCCAGGCATCACTGGG - Intergenic
997400537 5:133598549-133598571 TTCGTTTTTCAGGTACAACTGGG - Intronic
998846471 5:146315206-146315228 GTATTTTTCCAATTATAACTTGG + Intronic
1001491718 5:172160691-172160713 CTAGATGTGCAGGAATAACTTGG - Intronic
1003444149 6:6169545-6169567 CTAGTTTTCCAGGGATTGATGGG - Intronic
1003859669 6:10310898-10310920 CTAGGCTTCCTGCTATAACTAGG - Intergenic
1005155644 6:22803015-22803037 ATGGTTTTCCAGGTGTAACTCGG + Intergenic
1007197816 6:40077795-40077817 CTATTTTTCTAGTAATAACTAGG + Intergenic
1007278229 6:40691245-40691267 CTTGGTTTCCAGGTCTGACTGGG - Intergenic
1009245301 6:61230614-61230636 CTAGATTTCCAGATATATGTTGG - Intergenic
1009488662 6:64259116-64259138 CTGCTCTTCCAGGTATATCTAGG + Intronic
1009786840 6:68351386-68351408 CTAGTTTTCTAGTTCAAACTGGG + Intergenic
1010615340 6:78005745-78005767 CTAGTGTTCCAGGTGCCACTGGG - Intergenic
1011230012 6:85150206-85150228 CTAGTTTTCCAGGTTAATTTTGG - Intergenic
1011400465 6:86955934-86955956 CTAGTTTTTCAGGTTTACTTTGG - Intronic
1012130700 6:95488553-95488575 CTATTTTTACAGTGATAACTGGG - Intergenic
1012315324 6:97778426-97778448 CTAGTTTATCAGGTTTACCTTGG - Intergenic
1014615081 6:123588451-123588473 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1014977550 6:127907467-127907489 GGACTTTTCCAGGTATAACTAGG - Intronic
1015390025 6:132671168-132671190 CTAGTTTTCCAGTACTAGCTAGG + Intergenic
1015961401 6:138653202-138653224 TTATATTTCCAGGTCTAACTAGG + Intronic
1016212575 6:141557345-141557367 GTAGTTTTCCAGGAATATCTTGG + Intergenic
1017574048 6:155781694-155781716 TTAGTTTCCCAGGTATTAATTGG - Intergenic
1017782640 6:157728249-157728271 CTAGATCTCCAGGTACACCTGGG + Intronic
1020932963 7:14423146-14423168 ATAGTTTTCCATCTATAATTTGG - Intronic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1027532992 7:79358699-79358721 CTAGGCTTCCAAGTATCACTAGG - Intronic
1027620670 7:80481332-80481354 CTAGTTTTTCAGGTTTACTTTGG - Intronic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1029500974 7:100929702-100929724 CTAGTTTTGCAGGTTTACTTTGG + Intergenic
1031805804 7:126304732-126304754 ATAGTTGACCAGATATAACTGGG - Intergenic
1032674251 7:134113818-134113840 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1032893281 7:136222593-136222615 CTAGTTTTCCAGGTGCCACTGGG - Intergenic
1034286455 7:149886477-149886499 CTGCTTTTCCAGGAATATCTTGG - Intergenic
1035303912 7:157917405-157917427 CTTGTTTTCCAGCCATAACAGGG + Intronic
1035603005 8:908867-908889 CTTGTTTTCTAGCTATAACAAGG + Intergenic
1037331665 8:17749059-17749081 CTAGTTTTTCAGGTTAACCTTGG - Intronic
1037390976 8:18391458-18391480 TTAGTTTTCCAGGTTTCTCTGGG - Intronic
1039282944 8:36006532-36006554 CTAGTGTTCCAGGTGCCACTGGG - Intergenic
1042841513 8:73128980-73129002 TTACTTTTACAGGCATAACTTGG - Intergenic
1043036706 8:75208344-75208366 CTAGGGTTCCAGGTACCACTGGG + Intergenic
1044940286 8:97335161-97335183 CTGGCTTTCCAGGTGTCACTGGG + Intergenic
1050624159 9:7485930-7485952 CTTGATTTCCACGTATCACTGGG + Intergenic
1050796859 9:9557188-9557210 CTAGTTTTTCAAGTTTAATTTGG - Intronic
1056302665 9:85258170-85258192 CTGGTTTTCCAGGCACCACTGGG + Intergenic
1056995333 9:91452049-91452071 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
1058068189 9:100572847-100572869 CCAGTCTTACAGGTATATCTGGG + Intronic
1058179025 9:101773263-101773285 ATAGTTTTCTATGTATTACTTGG + Intergenic
1059127396 9:111703870-111703892 ATAATTTTGCAGGTAAAACTAGG - Exonic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1186811908 X:13198603-13198625 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1186884192 X:13896525-13896547 CTAGTTTTGTAGGTAAAACATGG + Intronic
1188511814 X:30944245-30944267 GTAGTTTTTCAAGTATAATTTGG + Intronic
1189176219 X:38959965-38959987 CTAGTTTTTCAGGTAAACTTTGG + Intergenic
1189303817 X:39971902-39971924 CTAGGGTTCCAGGTATAAGGAGG - Intergenic
1189592097 X:42524360-42524382 CTAGTTTTCCAGAGAGAAATAGG - Intergenic
1193934132 X:87594870-87594892 GTAGTTTTCTAGGAATATCTGGG + Intronic
1195840116 X:109166856-109166878 CTAAATTTCCTGGTATATCTGGG + Intergenic
1197538681 X:127726070-127726092 CTAGTATTCAAGGTATTACAAGG - Intergenic
1197836281 X:130697211-130697233 CTAGGTGTCCAGGTATATATAGG - Intronic
1198000321 X:132428128-132428150 ACAGTTTTGCAGCTATAACTCGG - Intronic
1198645528 X:138802111-138802133 CTGGGTTTCCAGGTATCACTGGG + Intronic
1201264696 Y:12194400-12194422 CTAGTCTTCCAGGTGGAAGTAGG + Intergenic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic