ID: 1022177824

View in Genome Browser
Species Human (GRCh38)
Location 7:27889060-27889082
Sequence ACATAGATACTACAATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022177822_1022177824 18 Left 1022177822 7:27889019-27889041 CCAGACAACGTGGAATATGTTCA 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG 0: 1
1: 0
2: 0
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022177824 Original CRISPR ACATAGATACTACAATGAGA TGG Intronic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
903872760 1:26448574-26448596 ACATAAATAATAACATGAGAGGG - Intronic
905096603 1:35477365-35477387 AAATAAAAACTACAATGAGATGG + Intronic
909551551 1:76903743-76903765 TGATAGATGCTACAATAAGAAGG + Intronic
911695638 1:100887997-100888019 ACATAGAAAATACAATGTGGCGG - Intronic
912242525 1:107926582-107926604 ACACAGCTACTACCAGGAGATGG - Intronic
912613397 1:111072249-111072271 ACATAAATACATCAATCAGAAGG - Intergenic
912871805 1:113313646-113313668 ACTTAGACAGTACAATAAGATGG + Intergenic
915152740 1:153847757-153847779 ACATGGACAGTAGAATGAGATGG - Intronic
916297599 1:163237030-163237052 ACATTGAAACCACAATGAGATGG + Intronic
922583772 1:226718630-226718652 AGAAAGAACCTACAATGAGATGG + Intronic
1064685693 10:17858934-17858956 GCATAGACAATAGAATGAGAAGG - Intronic
1066473049 10:35717885-35717907 ACAAAGATATTATAAAGAGATGG + Intergenic
1067262068 10:44701807-44701829 TAATAGATACTACAAAAAGAAGG - Intergenic
1067840827 10:49677979-49678001 ACATGCAGATTACAATGAGAAGG + Intergenic
1068859871 10:61837036-61837058 ACATAGATGCTAAAAAAAGAGGG - Intergenic
1074173501 10:110970783-110970805 AAATCGAAAGTACAATGAGAAGG - Intronic
1075107020 10:119546372-119546394 ACATTGTTACTACACTGTGAAGG + Intergenic
1076926483 10:133491776-133491798 ACATAGATAAGAAAATGAAAAGG + Intergenic
1078036298 11:7808703-7808725 TCATAAATACTACAATCAAATGG + Intergenic
1083989541 11:66238399-66238421 ACCTAGTTGCAACAATGAGATGG - Intronic
1086297375 11:85385453-85385475 AAATAGAAACTAGAATCAGAAGG + Intronic
1089641649 11:119851607-119851629 ACAAAAATACAACAATTAGACGG - Intergenic
1091741479 12:2963075-2963097 CCACAGATTCTACAGTGAGATGG - Intronic
1093343791 12:18014201-18014223 ACATAGATATTACATTGAAGAGG - Intergenic
1095082030 12:38013431-38013453 TCATAGATTCTACAAAAAGAGGG - Intergenic
1095324135 12:40867226-40867248 ACATAGAAACTAAAAAGACAAGG + Intronic
1097519365 12:60648044-60648066 ACATAAATTCTATAATGAGAAGG + Intergenic
1099865069 12:88269719-88269741 GAATAGATATTAAAATGAGAGGG + Intergenic
1106982046 13:35297925-35297947 CCATCAACACTACAATGAGAAGG + Intronic
1107789835 13:43990487-43990509 AAATAGTTACTAAAATTAGAAGG + Intergenic
1109435063 13:62288013-62288035 AAATAGACACTGGAATGAGAAGG - Intergenic
1109784790 13:67159315-67159337 ACATAGAAACCACAGTGAGGAGG + Intronic
1109928188 13:69175418-69175440 ACATAGATGCAACAACTAGATGG + Intergenic
1110160709 13:72374702-72374724 ACATAGAGACTGCACAGAGAGGG - Intergenic
1111133471 13:84006459-84006481 AAATGGATACTACCCTGAGACGG - Intergenic
1111605568 13:90534403-90534425 CCATAGTAACTACAATGGGAGGG - Intergenic
1115426559 14:33267249-33267271 ATATAGAAAGTACAATGAGCTGG - Intronic
1117390434 14:55256993-55257015 ACACAGAAACGGCAATGAGACGG - Intergenic
1117786671 14:59292935-59292957 ACAAATATAATACACTGAGAAGG + Intronic
1119187456 14:72652795-72652817 ACATAAATATTACAATCTGAAGG + Intronic
1120205202 14:81580331-81580353 ACAAAGAGGCTACAATGGGAAGG + Intergenic
1122200180 14:100117736-100117758 ACTTAGAAAATACAATGAGTTGG - Intronic
1125620022 15:41052232-41052254 ACATAGATACAACTGAGAGAAGG - Intronic
1126281751 15:46960582-46960604 ATAAAGATACATCAATGAGATGG + Intergenic
1127815542 15:62605737-62605759 ACTTAGATACACCAATGACATGG - Intronic
1128763176 15:70233031-70233053 ACATGGAGGCTACAACGAGAAGG - Intergenic
1133723505 16:8516715-8516737 ATATAGATACTTCAATGAATGGG - Intergenic
1134762674 16:16728007-16728029 GCATAAATACGAGAATGAGAGGG + Intergenic
1134983378 16:18631141-18631163 GCATAAATACGAGAATGAGAGGG - Intergenic
1135187686 16:20329344-20329366 AAATAGATCATACAATGAGGAGG - Intergenic
1135855058 16:26002056-26002078 ACATAGATACTATGAGGAGGAGG + Intronic
1137050598 16:35710235-35710257 TCATAGATTCTACAAAAAGAGGG - Intergenic
1137058473 16:35759465-35759487 TCATAGATTCTACAAAAAGAGGG + Intergenic
1137059108 16:35769751-35769773 TCATAGATTCTACAATAAGAGGG + Intergenic
1137072872 16:35922010-35922032 TCATAGATTCTACAAAAAGAGGG + Intergenic
1137073092 16:35925046-35925068 TCATAGATTCTACAAAAAGAGGG + Intergenic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1137661923 16:50214747-50214769 ACATAGATGGTACAGAGAGATGG + Intronic
1141279375 16:82617104-82617126 ACATAGATACCACAAAGACCAGG + Intergenic
1143752600 17:9040387-9040409 ACTTAGAAAATAAAATGAGAAGG - Intronic
1145364872 17:22251874-22251896 TCATAGATTCTACAAAAAGAGGG + Intergenic
1149679379 17:58494587-58494609 CAATAGATACTCCAATGATATGG - Intronic
1149702994 17:58671049-58671071 AGATAGAGAATAGAATGAGAGGG - Intronic
1150702289 17:67458325-67458347 GCATAGAGAGCACAATGAGAAGG - Intronic
1150885322 17:69079003-69079025 AAATTGATACAACAATGAGATGG - Exonic
1152301851 17:79499490-79499512 ACAAAGAAACCCCAATGAGAGGG + Intronic
1153143104 18:1997488-1997510 GCAAAGAAACTACAAAGAGAAGG + Intergenic
1153208592 18:2733380-2733402 ACATAAATACTATAATAATATGG + Intronic
1156023180 18:32622463-32622485 ACAGAGATAGTAGAATGACATGG - Intergenic
1160413669 18:78691934-78691956 ACATCTTTACCACAATGAGAAGG - Intergenic
1162581788 19:11535974-11535996 ACAGACCTACTACAATCAGAGGG + Intergenic
1164375717 19:27683215-27683237 TCATAGATTCTACAAATAGAAGG + Intergenic
1166246417 19:41530256-41530278 ACCTAGAAACCACAATGAGGAGG - Intergenic
925005674 2:441328-441350 ACAAAGATGCTAAAATGTGATGG - Intergenic
925529626 2:4844966-4844988 ACACAGATACTACCACGAGAGGG - Intergenic
926378344 2:12258276-12258298 AAATAAATGCTAGAATGAGAAGG + Intergenic
927337904 2:21946799-21946821 AAATAAATATTAAAATGAGAGGG + Intergenic
929897209 2:45972171-45972193 AAATTGAAGCTACAATGAGATGG - Intronic
930652536 2:53977025-53977047 ATATGGATATTAGAATGAGAAGG - Intronic
931103370 2:59027791-59027813 CCATAGATACTAATATGAGGAGG + Intergenic
932488104 2:72098479-72098501 AAATTAAAACTACAATGAGATGG - Intergenic
933359360 2:81259022-81259044 ACAGAGATATTACAAGCAGAAGG - Intergenic
934453002 2:94064155-94064177 ATACAGATACTACAAAAAGAGGG - Intergenic
935108010 2:100063632-100063654 AAATGGAGAATACAATGAGAAGG + Intronic
938205695 2:129420966-129420988 ACATTGAAAATACAAAGAGAAGG - Intergenic
939206421 2:139109982-139110004 ACAAAGATGCTACAAGGAAAGGG - Intergenic
939994077 2:148903745-148903767 ACATAGCTACTAAATTGTGAAGG + Intronic
940419739 2:153466086-153466108 ACAGAGATACAAAAATTAGATGG - Intergenic
940604474 2:155902799-155902821 ACTTAGGTACTACAATGTGTTGG - Intergenic
940827703 2:158432301-158432323 ACATAAATACTATAATTAAAAGG + Intronic
940857939 2:158744290-158744312 ACATAGTAAATACAATAAGAGGG + Intergenic
942368133 2:175251174-175251196 ATATATATATTACATTGAGATGG + Intergenic
942818489 2:180081383-180081405 ACATAGGTAATAAAATGAAAAGG - Intergenic
943005400 2:182383506-182383528 ACATATATAATACAAGGCGAAGG + Intronic
943399211 2:187384084-187384106 AAAGAAATACTACAATGAGGAGG - Intronic
943949784 2:194118950-194118972 ACATAGATCCCACAATCAAAAGG + Intergenic
946756912 2:222956606-222956628 AGATAGATAATTAAATGAGAAGG - Intergenic
947412725 2:229858528-229858550 ACACAGACACTAAAATGTGATGG + Intronic
1170779657 20:19412880-19412902 ACAGAGATACATCAAAGAGAAGG - Intronic
1171099262 20:22367334-22367356 ACACAGAAACTAAGATGAGAAGG - Intergenic
1172261437 20:33569380-33569402 GAATAAATACCACAATGAGAAGG + Intronic
1177642514 21:23861839-23861861 ACATTGTTAATACAAAGAGACGG + Intergenic
1177855052 21:26391507-26391529 TCATTGATATTACCATGAGAAGG - Intergenic
1178290058 21:31359492-31359514 ACATAGAAAATACAGTGAAAGGG + Intronic
1179200299 21:39212219-39212241 AAATAGATAATACAATTTGAAGG - Intronic
1182699116 22:32218784-32218806 TCATAGGTACTACACTGACAAGG - Intronic
1184026270 22:41859196-41859218 ATATAAATACCACAATGAAAAGG + Intronic
1184636752 22:45838465-45838487 CCATAGCTACTACAAATAGAAGG - Intronic
949106323 3:204130-204152 GCATAGATAATGCAATGAAATGG - Intronic
953176255 3:40555433-40555455 ACATGAATAATACAATGAAAAGG - Intronic
954941781 3:54379846-54379868 AAATAGCTATTTCAATGAGAAGG - Intronic
956009735 3:64817699-64817721 ACATATATACATCAATGACAGGG - Intergenic
956832823 3:73070095-73070117 ATATATATACAAAAATGAGACGG - Intergenic
958839062 3:99181525-99181547 ACTTTGCTACTAAAATGAGAGGG - Intergenic
959030297 3:101291597-101291619 ACATAGATTCTACCATGGTAGGG - Intronic
959356890 3:105343041-105343063 CCTGATATACTACAATGAGAAGG + Intergenic
959667973 3:108942688-108942710 ACAGAGTTAGTACAATGTGAGGG + Intronic
960340054 3:116463561-116463583 AGTTAGCTACTTCAATGAGATGG + Intronic
961851153 3:129820067-129820089 AAATAGATAGTTCAAGGAGAAGG - Intronic
963095356 3:141532950-141532972 AAATAGTTATTAAAATGAGAGGG - Intronic
963851488 3:150214985-150215007 AAATGGAAACTGCAATGAGATGG - Intergenic
964337083 3:155666943-155666965 AGACAGATACTAAAATGAGCAGG + Intronic
966377387 3:179310326-179310348 ACATGGATAATCCTATGAGATGG + Intergenic
967508677 3:190284606-190284628 AAAAAGATACTACATGGAGATGG - Intergenic
968839527 4:2992271-2992293 AGATAGATTCTTCAATGATAAGG + Exonic
970080603 4:12280351-12280373 TCATAGATACTACAAAAAGAGGG + Intergenic
974687099 4:65244119-65244141 ACATACATACATAAATGAGAGGG - Intergenic
978845973 4:113273109-113273131 AAACAGATACTACAATAAGATGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979359445 4:119744624-119744646 TAATAGAAACTACAATAAGATGG + Intergenic
979474271 4:121136294-121136316 GTATAGATACAAAAATGAGAAGG - Intronic
982779590 4:159477105-159477127 TCATAGGTACTACAAAGAGAGGG - Intergenic
983105203 4:163678265-163678287 GCATAGAAACAACACTGAGATGG - Intronic
983113496 4:163782506-163782528 ACAAAGATACAAAAATGAGCAGG + Intronic
992389015 5:76313344-76313366 ACATATATAATATAATGATAAGG - Intronic
993331180 5:86602310-86602332 ACATAGAAGGTATAATGAGAAGG - Intergenic
993929712 5:93922856-93922878 ACATGGATCCTTCAATGATATGG + Intronic
994322470 5:98409029-98409051 AGAAAGAAACTACAATCAGAAGG - Intergenic
994336980 5:98578510-98578532 ACATAGATAATAAAAAGGGAAGG - Intergenic
994409983 5:99395294-99395316 TCATAGATAATACAATCAAATGG + Intergenic
996350977 5:122541210-122541232 TCAAAAATACTAGAATGAGAAGG - Intergenic
996425276 5:123307298-123307320 ACATAGATAATACTATAGGAGGG + Intergenic
996575560 5:124973472-124973494 AAATAAATAATAAAATGAGAAGG - Intergenic
998828277 5:146128733-146128755 ACATAGATGGTGCAATGTGAGGG + Exonic
998875190 5:146592053-146592075 AAATAAATAATAAAATGAGAGGG + Intronic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
999947636 5:156614412-156614434 ACATTGTTATCACAATGAGAGGG + Intronic
1000733720 5:164871060-164871082 ATAGAAATAGTACAATGAGAAGG + Intergenic
1000868181 5:166540780-166540802 ACAGTAATACTAAAATGAGAGGG + Intergenic
1001433288 5:171680433-171680455 ACACAGATAACACAGTGAGAGGG - Intergenic
1003308382 6:4948205-4948227 ACATAGATCATACAGTGGGAGGG - Intronic
1004611215 6:17241553-17241575 ACATAGAGCATACAGTGAGAAGG - Intergenic
1005787653 6:29262822-29262844 AGATGGATACCACAATGAGATGG + Intergenic
1005788167 6:29268665-29268687 AGATGGATACCACAACGAGATGG + Intergenic
1008449623 6:51635596-51635618 ACATAGATACTATAAAGCCAGGG + Intronic
1008738224 6:54573548-54573570 ACTTAGATACTACACTGACTGGG - Intergenic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1009788772 6:68372482-68372504 ACATAGCTGCTACAGTGAGTGGG + Intergenic
1014004943 6:116407286-116407308 ATATTGATACTCAAATGAGATGG + Intronic
1014398065 6:120951323-120951345 ACAGAGATAGAAAAATGAGACGG + Intergenic
1014923802 6:127246403-127246425 AGATAGATAATAGATTGAGATGG + Intergenic
1015606426 6:134959902-134959924 GAATAGAGACTAGAATGAGAAGG - Intergenic
1016564368 6:145436552-145436574 AAATAAAAACTACAAAGAGATGG - Intergenic
1016640589 6:146344364-146344386 ATACAGATTCTACAATAAGAAGG - Intronic
1017630254 6:156389925-156389947 ACATTGCTACTTCAGTGAGAAGG - Intergenic
1018012669 6:159685874-159685896 ACAAAGATAGTACAGTGAGTGGG - Intronic
1019720327 7:2566412-2566434 ACATATGCATTACAATGAGAAGG - Intronic
1020383297 7:7569088-7569110 ACATTGATTTTTCAATGAGATGG + Intronic
1021170447 7:17392632-17392654 ACATAAATTCTACAAAGACAGGG + Intergenic
1021494247 7:21256706-21256728 ACATAAATATCACAATGAAAAGG - Intergenic
1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG + Intronic
1023290293 7:38660908-38660930 AAATAGTTACTAAAATTAGAAGG + Intergenic
1023482980 7:40654885-40654907 AAATAGACAATACAATTAGAGGG + Intronic
1025294739 7:57768170-57768192 TCATAGATATTACAAAAAGAGGG + Intergenic
1025720119 7:64002175-64002197 ACATAAATAGTACAAGGAGCTGG - Intergenic
1026060533 7:67021595-67021617 ACACAGATACTACATCGAAAGGG - Intronic
1026061125 7:67027299-67027321 ATATAGATAGTAGAATCAGATGG + Intronic
1026717236 7:72800093-72800115 ATATAGATAGTAGAATCAGATGG - Intronic
1027576482 7:79937015-79937037 ACATAAATAATTGAATGAGAAGG - Intergenic
1027714426 7:81652386-81652408 AAATAGATACTGCAAAAAGAGGG + Intergenic
1028330366 7:89583657-89583679 GCTTAGATTCTACAATGTGAAGG + Intergenic
1030489664 7:110215763-110215785 AACTAGAAAATACAATGAGAAGG + Intergenic
1036173935 8:6518136-6518158 ACATAGATGAAACAATGTGATGG + Intronic
1038615943 8:29095248-29095270 ACAAAGATACCACACTGAGTGGG + Intronic
1038894976 8:31772489-31772511 GAATAGATACTACTAGGAGATGG - Intronic
1038949206 8:32395449-32395471 AAATTCAAACTACAATGAGATGG - Intronic
1039931540 8:41995174-41995196 ACATAGAAAGAACAATGAGTTGG + Intronic
1040118417 8:43652004-43652026 TCACAGATTCTACAAAGAGAAGG - Intergenic
1040118736 8:43656484-43656506 TCATAGATTCTACAAAAAGAGGG - Intergenic
1040282028 8:46060869-46060891 TCATAGATTCTACAAATAGAAGG - Intergenic
1040812371 8:51469468-51469490 ACATCGAGACTACAATGCAAAGG - Intronic
1041643156 8:60224731-60224753 ACAATGTTACTCCAATGAGAAGG - Intronic
1041833431 8:62182915-62182937 GAATAGAAACTACATTGAGAAGG + Intergenic
1041854845 8:62439573-62439595 ACATAGAAAGTAACATGAGAGGG - Intronic
1043140505 8:76583002-76583024 ACATAGATTCTCTAATGTGAGGG + Intergenic
1046200237 8:110917169-110917191 AAATAGATATTACAATGACAGGG - Intergenic
1046872263 8:119216680-119216702 ATATAGATAATAGAATTAGAAGG + Intronic
1047556522 8:125938003-125938025 AGATAAATACTACAATTACAAGG + Intergenic
1048116413 8:131528743-131528765 ACATAATTAAAACAATGAGATGG + Intergenic
1048257515 8:132916427-132916449 GAATAGATACAAAAATGAGAGGG - Intronic
1050787557 9:9424556-9424578 ACAAAGATAATAGAATCAGAAGG + Intronic
1051610555 9:18957737-18957759 ACATAGATCCTTCTTTGAGAAGG - Intronic
1051887496 9:21909627-21909649 ACATAGATTCTACACTGAATGGG - Intronic
1051969409 9:22869193-22869215 ACATAGAAACTTTAATGACAAGG - Intergenic
1055145646 9:72931474-72931496 GCAAAGATTCTACAATCAGATGG - Intronic
1055444864 9:76372367-76372389 ACACAGCTACTAAAATGATATGG - Intergenic
1055692435 9:78846806-78846828 ACATAGCTAGTACCAGGAGATGG + Intergenic
1057224355 9:93281542-93281564 ATATAGAGATTACAGTGAGATGG + Intronic
1060253815 9:122007641-122007663 ACATAGATAGTTAAATCAGAAGG + Intronic
1060286206 9:122255174-122255196 ATATAGAAATTACTATGAGATGG + Intronic
1060291954 9:122311374-122311396 AAAAAGATACTACAAGGAAATGG - Intronic
1060382648 9:123191183-123191205 ACACAGATAATACATGGAGAGGG + Intronic
1061686914 9:132288409-132288431 ACATATACAACACAATGAGAAGG + Intronic
1203776646 EBV:76972-76994 ACATAGATACTTGAATGCGGAGG - Intergenic
1185841158 X:3392472-3392494 TCATCGATTCTACATTGAGAAGG + Intergenic
1187649780 X:21390113-21390135 AAACAGAAACTACAATTAGAAGG - Intronic
1188131406 X:26437929-26437951 ACATAAACCCTACAAGGAGAGGG - Intergenic
1188429124 X:30085517-30085539 GCATAGATAGTACAATAAGATGG - Intergenic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1189561840 X:42199020-42199042 AAATTAAAACTACAATGAGATGG - Intergenic
1191231140 X:58096574-58096596 TCATAGATTCTACAATAAAAGGG - Intergenic
1191238968 X:58164050-58164072 ACATAGATTCTACAAGAAGAGGG - Intergenic
1191239314 X:58169117-58169139 TCGTAGATTCTACAATAAGAGGG - Intergenic
1191259342 X:58297067-58297089 ACACAGATTCTACAAAAAGAGGG - Intergenic
1192122288 X:68467749-68467771 ACATAGACAAATCAATGAGAAGG + Intergenic
1193292577 X:79792943-79792965 AAATTAAAACTACAATGAGATGG - Intergenic
1194987868 X:100510768-100510790 ACATAGGTCTAACAATGAGATGG - Intergenic
1195466816 X:105188542-105188564 GCACAGATTCTATAATGAGAGGG + Intronic
1199002664 X:142657767-142657789 ACAATGATAATATAATGAGATGG + Intergenic
1200296965 X:154929652-154929674 ACAGATAGACTACAATGAGAAGG - Exonic