ID: 1022177861

View in Genome Browser
Species Human (GRCh38)
Location 7:27889281-27889303
Sequence GGTTCAATGGGGAAATATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022177852_1022177861 24 Left 1022177852 7:27889234-27889256 CCAGGTGATTTCAACGTTCATCC 0: 1
1: 0
2: 3
3: 50
4: 353
Right 1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1022177853_1022177861 3 Left 1022177853 7:27889255-27889277 CCTGATCGAAAATCACTGTTTTC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022177861 Original CRISPR GGTTCAATGGGGAAATATGG GGG Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
902127357 1:14227022-14227044 GGTTCAAGGGGTAAATGTGCAGG - Intergenic
904433775 1:30480833-30480855 GGTTCAATGGGGGATTCAGGGGG + Intergenic
908530739 1:65031191-65031213 TTTACAGTGGGGAAATATGGTGG + Intergenic
908656780 1:66396447-66396469 TTTTCAATGGGTTAATATGGGGG + Intergenic
909106622 1:71418210-71418232 AGTTCAATGGGGAAAAAATGTGG + Intronic
911626697 1:100132683-100132705 AGGCCAATGGGGAAAGATGGCGG - Intronic
913381412 1:118215187-118215209 GTTTCAACTGTGAAATATGGTGG + Intergenic
914337356 1:146727291-146727313 GGTAAAATGGGGAAAGATAGTGG - Intergenic
921321579 1:213945484-213945506 GGTTCAATTGGGATATCTTGTGG - Intergenic
922776876 1:228218783-228218805 GCTTCCAGGGGGAAATATGTGGG + Intronic
1063885049 10:10568823-10568845 GGTTTACTAGGGAAGTATGGTGG + Intergenic
1063889940 10:10618847-10618869 GGTTCCATGGTGAAATACAGGGG + Intergenic
1064777998 10:18801198-18801220 GGTTCAAGGGGCACATATAGAGG - Intergenic
1064831315 10:19470099-19470121 GGTGGAAGGGGGAAATGTGGAGG - Intronic
1065052951 10:21814510-21814532 GGTTCACTTGGGAGATAAGGGGG + Intronic
1065545860 10:26819770-26819792 GGATGAATAGGAAAATATGGGGG + Intronic
1078771398 11:14356071-14356093 TGTAAACTGGGGAAATATGGTGG - Intronic
1089146500 11:116333067-116333089 GGGTCAGGGGTGAAATATGGGGG - Intergenic
1090474520 11:127007473-127007495 GGTTAAATGTGGTCATATGGGGG - Intergenic
1091399888 12:175304-175326 GGTCCAATGGGGGAAAGTGGTGG - Exonic
1091630430 12:2155920-2155942 GAGTCATTGGGGAACTATGGAGG - Intronic
1093268880 12:17033563-17033585 GGTTCAATGGCAAAAAATGAAGG + Intergenic
1093923795 12:24889353-24889375 TGATAAATGGGGAGATATGGTGG - Intronic
1095966020 12:47867630-47867652 AGTTAGATGGGGAAAGATGGTGG + Intronic
1096812158 12:54177986-54178008 GGTTAAATTGGGTAATAAGGGGG + Intronic
1101067442 12:101037264-101037286 TGTTCAATGGGTAATTAGGGAGG + Intronic
1102232902 12:111275827-111275849 GGTTCAAAGGGGAGAGCTGGTGG - Intronic
1105446229 13:20459816-20459838 GGTTCAAGGGGTACATATGCAGG - Intronic
1108460609 13:50663600-50663622 GGTTAAATGGGAAAATATATGGG - Intronic
1108529334 13:51314421-51314443 GGTTCAAGGGGTACATATGCAGG - Intergenic
1109925234 13:69128196-69128218 GATTCAAGGGGGATATATGCAGG - Intergenic
1110579654 13:77106766-77106788 GGTTCAAGGGGGACATGTGTAGG + Intronic
1110740360 13:78988792-78988814 GGCCCAAGGGGGAAACATGGGGG + Intergenic
1113264161 13:108598625-108598647 GTTTCAATGGTGAAATAGGCAGG + Intronic
1115049136 14:29035127-29035149 ATTTCAATGGGAAAATATGTTGG + Intergenic
1116240158 14:42331081-42331103 GGTTCAATGGGTATATCTGCAGG + Intergenic
1116536611 14:46039792-46039814 GGTTCGATGGGTAAATGTGAAGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121132521 14:91461335-91461357 GCTTCAATTGGGAAAAAAGGGGG + Intronic
1126213573 15:46128680-46128702 GGTTCAAGGGGTAGATATGTGGG + Intergenic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1127006959 15:54581588-54581610 GGTTAAATGAGGTAATAGGGTGG - Intronic
1131342751 15:91617993-91618015 GGTTTAATGAGGTAATAAGGTGG + Intergenic
1133841128 16:9410715-9410737 GATTCAATGAGGAAATGTGTGGG - Intergenic
1138529849 16:57629153-57629175 GGTGAAATGGGGAAATGGGGGGG + Intronic
1138948989 16:61887619-61887641 GGTTAAATGGGGTCACATGGTGG - Intronic
1139996922 16:70990035-70990057 GGTAAAATGGGGAAAGATAGTGG + Intronic
1143692949 17:8586167-8586189 GCTTCAGTGGGAAAGTATGGAGG - Intronic
1144255173 17:13460561-13460583 GGTCCCATGGGGATATTTGGGGG - Intergenic
1146821240 17:35984929-35984951 GGTTCAATGGGGACATGGGCAGG - Intronic
1148226103 17:45898841-45898863 GGATAAATGGGGAAATACAGTGG + Intronic
1148622023 17:49041963-49041985 GAATCAATGGGGAAACTTGGAGG + Intronic
1150268640 17:63848183-63848205 GGTACCATGGGGAAACAAGGAGG + Intergenic
1155728045 18:29114582-29114604 GTTTCAATGGAAAAATATTGAGG - Intergenic
1156275290 18:35578209-35578231 GGTTTAATGGAGAGATGTGGGGG - Intergenic
1159579081 18:70214850-70214872 GGGTCATTGGGGAAATAGAGTGG + Intergenic
1163382531 19:16978371-16978393 GGTTAAATGGGGACAGATTGTGG + Intronic
928937191 2:36691329-36691351 GGTTGAAAGGGGAGAGATGGTGG + Intergenic
930119499 2:47748455-47748477 AGTGCGGTGGGGAAATATGGGGG + Intronic
938856542 2:135317956-135317978 GGTGCAAAGGGGAAATAAGAGGG + Intronic
940170409 2:150824053-150824075 GGTTCAAAGGGTACATATGCAGG - Intergenic
942544489 2:177048920-177048942 GCTTCATTGGGGAAAAAAGGAGG - Intergenic
942600837 2:177639458-177639480 TGTTCTATGGGGAAGAATGGAGG - Intronic
945386267 2:209205005-209205027 GGTACAATGTTGAAATGTGGTGG - Intergenic
945487317 2:210412177-210412199 GGTTCAAGGGGTACATATGCAGG + Intergenic
947288342 2:228543415-228543437 GATAGAATGGGGAAAAATGGAGG + Intergenic
947915244 2:233828420-233828442 GATTTAATAAGGAAATATGGGGG - Intronic
1169865455 20:10195178-10195200 GGGACAATGGAGAAAAATGGTGG - Intergenic
1171209975 20:23309476-23309498 GGTTCCATGGGCAAGCATGGAGG - Intergenic
1171895335 20:30753131-30753153 GGTTCAGTGGGTACATGTGGAGG - Intergenic
1172899751 20:38325873-38325895 GCTTCAAGGGGGAACTAAGGAGG - Intronic
1174223092 20:48973047-48973069 AGTTCACTGGGGAAATTTGTTGG + Intronic
1177779787 21:25609703-25609725 TTTTCAATGGAGAAATCTGGTGG + Intergenic
1178030703 21:28522226-28522248 GGTTCAATGAGGAATAAAGGAGG + Intergenic
1178304444 21:31479780-31479802 GTATCAATGTGGAGATATGGGGG - Intronic
1179401329 21:41086709-41086731 GGTTAAATGGGAACATATGGCGG + Intergenic
1184925786 22:47636329-47636351 GGCTCAATGGGGAAAAAGAGAGG - Intergenic
949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG + Intergenic
952486330 3:33815227-33815249 GGTTGAATTGGGGATTATGGAGG + Intronic
955080003 3:55649725-55649747 GGCTCCATGGGGAAATGAGGAGG - Intronic
957901368 3:86497708-86497730 GGTTCAAGGGGTACATATGAAGG - Intergenic
965402672 3:168231645-168231667 CCTTCAATAGGGATATATGGAGG - Intergenic
965533342 3:169798835-169798857 GGTGCCATGGGGACATAAGGAGG - Intronic
965564678 3:170102093-170102115 GGTTAAATTAGGAAATAAGGAGG + Intronic
976330989 4:83830960-83830982 GGGGCAAGGGGCAAATATGGGGG - Intergenic
980498525 4:133616813-133616835 GGTACAATAGGGAAACATGGTGG + Intergenic
980558818 4:134443907-134443929 GGTGCAATGGAGAAATGTGTAGG + Intergenic
981514031 4:145587825-145587847 GGTACCTTGGGGAAATAGGGAGG - Intergenic
982392198 4:154876931-154876953 GGTTAAATGAGGATATAAGGTGG + Intergenic
984621387 4:181956261-181956283 GTTTCAATGTGGAAATTTTGAGG + Intergenic
992076691 5:73198566-73198588 GGTTTAATGTGGAAATATCATGG - Intergenic
992182833 5:74214838-74214860 GGCTCAGTGGGGATCTATGGAGG - Intergenic
995082343 5:108067740-108067762 AGTACAATAGGGAAATATGTAGG - Intronic
996195425 5:120600591-120600613 GGTTCAGGGGGTAAATATGGAGG + Intronic
998005453 5:138654062-138654084 GGGACAGTGGGGATATATGGAGG - Intronic
999541501 5:152579134-152579156 GGTTCAATGGGTACATATGCAGG + Intergenic
1001398981 5:171435627-171435649 GGGTCCATGGGGAAAGAAGGAGG - Intronic
1003291092 6:4778540-4778562 GGTTTCATGGGGAAATACTGAGG + Intronic
1010339668 6:74733761-74733783 TGCTCAATGGGGCAATATGCAGG - Intergenic
1016430905 6:143984321-143984343 GGTTGTATGGTGAAATATGCTGG + Intronic
1017012913 6:150075195-150075217 GTTTCTCTGGGGTAATATGGGGG + Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1022559665 7:31335801-31335823 GGATCAAGGGAGAAAGATGGGGG + Intergenic
1022811809 7:33876176-33876198 GGTTCAAGGAGGAAATTTGGGGG + Intergenic
1030485083 7:110155408-110155430 GGTTCATTGAGAAACTATGGGGG + Intergenic
1030969334 7:116034941-116034963 GTTTCAGTGGGGGAAGATGGGGG - Intronic
1031732892 7:125320096-125320118 GGTGCAAAGGGGAAATGTAGGGG + Intergenic
1041080249 8:54208846-54208868 GGTTCAATGAGGTCATAAGGGGG - Intergenic
1041292330 8:56319654-56319676 GGTTGAAAGGGGTGATATGGGGG + Intronic
1043290598 8:78595456-78595478 GGTTCAAGGGGTACATATGCAGG + Intronic
1044652428 8:94511009-94511031 TGGTCATTGAGGAAATATGGGGG - Intronic
1046420496 8:113976632-113976654 GGTTCAGGTGAGAAATATGGAGG - Intergenic
1053031488 9:34783046-34783068 GGATCAATTGGGAATTCTGGAGG - Intergenic
1054812521 9:69446283-69446305 TGTTGAATGGGGAAATGTGATGG - Intronic
1057677537 9:97147531-97147553 GGGTGAATTGGGAATTATGGAGG - Intergenic
1059803820 9:117777068-117777090 GGCTGAAAGGGGAGATATGGTGG + Intergenic
1060983661 9:127807790-127807812 GTTTCAATGGGGAAATAGTCTGG - Intronic
1187466705 X:19533820-19533842 TGTTCACTTGGGAAAGATGGGGG + Intergenic
1187730565 X:22249535-22249557 GTTTGAATGGAGAAAAATGGAGG + Exonic
1189680739 X:43513407-43513429 GGTGCAACCTGGAAATATGGGGG + Intergenic
1192426211 X:71079201-71079223 GCTAAGATGGGGAAATATGGGGG - Intergenic
1195031572 X:100931752-100931774 GTTTCAAGGAGGAAGTATGGGGG - Intergenic