ID: 1022179855

View in Genome Browser
Species Human (GRCh38)
Location 7:27908668-27908690
Sequence GGGGCCCAGTTTACCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022179850_1022179855 13 Left 1022179850 7:27908632-27908654 CCAAAAAAACAGGACAGTCACAG 0: 1
1: 0
2: 6
3: 25
4: 250
Right 1022179855 7:27908668-27908690 GGGGCCCAGTTTACCTAAGCTGG No data
1022179849_1022179855 21 Left 1022179849 7:27908624-27908646 CCAGTTTTCCAAAAAAACAGGAC 0: 1
1: 0
2: 4
3: 24
4: 277
Right 1022179855 7:27908668-27908690 GGGGCCCAGTTTACCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022179855 Original CRISPR GGGGCCCAGTTTACCTAAGC TGG Intronic
No off target data available for this crispr