ID: 1022182369

View in Genome Browser
Species Human (GRCh38)
Location 7:27933766-27933788
Sequence CAAGCTTGCCAGAACTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022182369_1022182372 -1 Left 1022182369 7:27933766-27933788 CCTGCTGAGTTCTGGCAAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1022182372 7:27933788-27933810 GGCAGACTGCAGAACATAATGGG 0: 1
1: 0
2: 1
3: 14
4: 123
1022182369_1022182371 -2 Left 1022182369 7:27933766-27933788 CCTGCTGAGTTCTGGCAAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1022182371 7:27933787-27933809 TGGCAGACTGCAGAACATAATGG No data
1022182369_1022182376 15 Left 1022182369 7:27933766-27933788 CCTGCTGAGTTCTGGCAAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1022182376 7:27933804-27933826 TAATGGGAAGGCGGTTGGAGTGG No data
1022182369_1022182375 10 Left 1022182369 7:27933766-27933788 CCTGCTGAGTTCTGGCAAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1022182375 7:27933799-27933821 GAACATAATGGGAAGGCGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 142
1022182369_1022182374 6 Left 1022182369 7:27933766-27933788 CCTGCTGAGTTCTGGCAAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1022182374 7:27933795-27933817 TGCAGAACATAATGGGAAGGCGG 0: 1
1: 0
2: 3
3: 39
4: 377
1022182369_1022182373 3 Left 1022182369 7:27933766-27933788 CCTGCTGAGTTCTGGCAAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1022182373 7:27933792-27933814 GACTGCAGAACATAATGGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022182369 Original CRISPR CAAGCTTGCCAGAACTCAGC AGG (reversed) Intronic
901462220 1:9398518-9398540 CATGCTGCCCTGAACTCAGCTGG - Intergenic
901555461 1:10028481-10028503 CAGGCGTGGCAGCACTCAGCAGG - Intergenic
907650677 1:56291863-56291885 CAAGCTTGCCAGAGCAAAGAAGG + Intergenic
910015863 1:82522379-82522401 CAAGCTGGCGAGAAGTGAGCAGG + Intergenic
911033715 1:93516411-93516433 AAAGCTTGCCAGAACTCCTGTGG - Intronic
911631509 1:100188846-100188868 CCAGCTTGCTAAAACTGAGCAGG - Exonic
912800852 1:112719030-112719052 CCAGCTCTGCAGAACTCAGCCGG - Intergenic
912873237 1:113328815-113328837 CAACCCAGGCAGAACTCAGCTGG - Intergenic
915223221 1:154391613-154391635 GAACCTAGCCAGAAGTCAGCTGG - Intergenic
915364335 1:155305939-155305961 CAATATTGCCAGACCACAGCTGG - Intergenic
918047671 1:180951362-180951384 CAAGCTGGACAGAACTAAGATGG - Exonic
918076349 1:181174123-181174145 CAAACTTGCCAGAACCAAGATGG + Intergenic
920860722 1:209704271-209704293 CAAGCCAGCCAGAACCCAGATGG - Intronic
921191794 1:212715755-212715777 CACCATTGACAGAACTCAGCTGG + Intergenic
923415017 1:233748438-233748460 CAGGCTTGGCAGGTCTCAGCTGG - Intergenic
924320290 1:242842012-242842034 CAAACTTGGCAGACCTCAGAAGG - Intergenic
1062858273 10:790379-790401 CAAGCTGGTCAGCCCTCAGCAGG + Intergenic
1063299281 10:4837080-4837102 CATGCTTGCCAGACATCAGGAGG + Intronic
1063662707 10:8045077-8045099 CAACCCTGCCAGAAGACAGCGGG + Intergenic
1067538547 10:47135306-47135328 CCAGCTGACCATAACTCAGCAGG - Intergenic
1069738727 10:70674102-70674124 CAAACTTCCAAGAACGCAGCTGG - Intronic
1076332038 10:129677383-129677405 CAAGGTTACCATAAATCAGCAGG + Intronic
1078407218 11:11080914-11080936 CAAGGCAGCCAGACCTCAGCTGG - Intergenic
1084441299 11:69175204-69175226 TGAGTTTGCCAGAACTCAGCTGG - Intergenic
1089756030 11:120688029-120688051 CAAGGCTGCCAGAGCTCTGCTGG + Intronic
1091535665 12:1406210-1406232 ATAGCTTGCCTGAAGTCAGCTGG + Intronic
1092158681 12:6302824-6302846 CAAGTTAGTCAGATCTCAGCTGG + Intergenic
1092285890 12:7129159-7129181 CAAGCCTGCCAGAAATGAGGTGG - Intergenic
1095331287 12:40967556-40967578 AAAGCTTTACAGAACTTAGCAGG + Intronic
1097053587 12:56237674-56237696 CATGCTTGCCATAACCCTGCTGG + Exonic
1097707172 12:62880435-62880457 CCTGCCTGCCAGAACCCAGCAGG + Intronic
1100430330 12:94526804-94526826 CAGGCTTGGCTGATCTCAGCTGG + Intergenic
1101856958 12:108451773-108451795 CAAGCTGGCCATCTCTCAGCTGG - Intergenic
1110350748 13:74504357-74504379 CAGACTTGGTAGAACTCAGCAGG - Intergenic
1110718218 13:78731797-78731819 CCAGCTTGCCAGAAAGCAGGAGG - Intergenic
1114364133 14:22008906-22008928 CAAACTGGCCAGAACTCAAAGGG - Intergenic
1114956996 14:27835026-27835048 CAATCTGGGCTGAACTCAGCTGG + Intergenic
1124856084 15:33390729-33390751 CTAGATTCCCAGAACTAAGCAGG - Intronic
1128996859 15:72303788-72303810 GAAGCTGGCCAGAACCCAGCTGG + Intronic
1130573632 15:85071243-85071265 CAGGCTTGGCAGAACACAGTGGG - Intronic
1133458119 16:5960952-5960974 CAAGATGGCCAGAAGACAGCAGG + Intergenic
1137747642 16:50834860-50834882 CAAGTGGACCAGAACTCAGCGGG + Intergenic
1138560400 16:57797767-57797789 CAAGCTGGTCAGAGCTCTGCGGG - Intronic
1141246682 16:82314329-82314351 CAGGCTTGACTGAGCTCAGCAGG - Intergenic
1141688641 16:85584278-85584300 CCAGCTAGCCAGTTCTCAGCTGG - Intergenic
1146796229 17:35783419-35783441 CAGACTTGCCTGACCTCAGCTGG + Intronic
1147205396 17:38833855-38833877 AAAGCTTGCCAGAACTCGTGTGG - Intergenic
1152318585 17:79595219-79595241 CAAGCTTGCCAGAAAGAAACCGG + Intergenic
1156926595 18:42588111-42588133 CAAGCTTGCCATCTCTCAGTTGG + Intergenic
1157941330 18:51932012-51932034 AAAACCTCCCAGAACTCAGCAGG - Intergenic
1159912083 18:74155089-74155111 CAAGCTTGCCTGCTCCCAGCCGG + Intronic
1166350732 19:42196850-42196872 CGTGCTTGCCAGAAGTCAGGAGG - Intergenic
934480284 2:94632952-94632974 CAATCTGGGCTGAACTCAGCTGG - Intergenic
935087852 2:99866023-99866045 CAAGCTTTCCAGAAATAAACAGG + Intronic
935715713 2:105937366-105937388 CAAGCTCTTCAGAACTCATCTGG + Intergenic
936718157 2:115214803-115214825 CAAGCAAGCAAGAACTCAGTTGG - Intronic
937245123 2:120487526-120487548 CAACATTGCCAGATCACAGCTGG - Intergenic
937730744 2:125225376-125225398 CAAGCAAGTGAGAACTCAGCGGG - Intergenic
946015034 2:216597157-216597179 CAAGCTTGCCAGATCTCTGGTGG - Intergenic
946144095 2:217715676-217715698 CAGGCTTGGCTGATCTCAGCTGG - Intronic
948476543 2:238224433-238224455 CACACTTGTCAAAACTCAGCAGG + Intergenic
1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG + Intronic
1172574489 20:35997219-35997241 GAAGCATGCCAGTACTGAGCAGG - Intronic
1173393370 20:42655191-42655213 GAAATTTGCCAGATCTCAGCTGG + Intronic
1175526354 20:59637099-59637121 CCAGCTTGCCACACCTCTGCAGG + Intronic
1176190992 20:63809480-63809502 CAAACCTGCCAGAGCCCAGCAGG + Intronic
1181566782 22:23743611-23743633 CAAGCACGCCAGCTCTCAGCAGG - Exonic
1184430795 22:44440682-44440704 CAAGCTTTCAGGAACGCAGCTGG + Intergenic
1185028092 22:48426996-48427018 CAAGCGCACCAGACCTCAGCAGG - Intergenic
949277995 3:2309859-2309881 CAAGCATGCCAGAATTGAGCTGG - Intronic
953288769 3:41640560-41640582 GAAGCTTGACAGAGCTCAGGAGG - Intronic
953661955 3:44897885-44897907 CTGGCTTGCTAGAAGTCAGCTGG + Intronic
960623775 3:119660710-119660732 GAAGCTTGCCAGAGCTCTGCAGG - Intronic
961041042 3:123678496-123678518 CATGCTTGTCAGTGCTCAGCAGG + Intronic
962173756 3:133130322-133130344 CAATCTGGCCAGGGCTCAGCAGG + Intronic
963537318 3:146544575-146544597 CAACCTTCTCAGAAGTCAGCCGG + Exonic
963954221 3:151235310-151235332 AGAGCTTGACAAAACTCAGCTGG - Intronic
965216098 3:165866724-165866746 CAGGCCTGGCAGAACTCACCTGG - Intergenic
965630726 3:170730047-170730069 CATTCATTCCAGAACTCAGCTGG + Intronic
965845852 3:172960791-172960813 CAAGGTAGCCAGAATTAAGCTGG + Intronic
967348413 3:188484887-188484909 CAAGCTTCCCAGAGTTCTGCTGG + Intronic
969637220 4:8376458-8376480 AAATCTTCCCAGAACACAGCAGG + Intronic
969870143 4:10099392-10099414 AAATCTTGCCAGAAATCATCTGG + Intronic
970258974 4:14203640-14203662 CATGTTTCTCAGAACTCAGCAGG - Intergenic
972872754 4:43320533-43320555 CAATGTTACCAGAGCTCAGCAGG - Intergenic
973223394 4:47754335-47754357 CCAGGTTGCCAGAACTCATGTGG + Intronic
974328905 4:60450965-60450987 CCAGCTGGCTAGAACACAGCAGG + Intergenic
974636530 4:64570625-64570647 CAATTTTGGCAGTACTCAGCAGG + Intergenic
979498495 4:121411663-121411685 CCTGCTGGCCAGAACTCAGGGGG - Intergenic
980449511 4:132951406-132951428 AAAGCTTGGTAGAATTCAGCAGG - Intergenic
981123094 4:141074729-141074751 AAACCTTCCCAGAAATCAGCTGG + Intronic
981314633 4:143330111-143330133 GAAGCTTGCCAGTAGTCAGTTGG - Intergenic
983908711 4:173211964-173211986 CAAGGCTGCCAGATATCAGCAGG + Intronic
987845876 5:23284629-23284651 CAAGATTGCCAGAATTAACCAGG - Intergenic
993395764 5:87386078-87386100 CAGCCTTGCCAGAACTCATTGGG + Intronic
993888898 5:93448639-93448661 CAAGCCTGCCAGCTTTCAGCTGG - Intergenic
995469361 5:112484319-112484341 TCAGCTTCCCAGAACACAGCAGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
999113344 5:149141193-149141215 CAAGCTTGCCAGAGCAGAGCCGG + Intergenic
1000025119 5:157352353-157352375 CAAGCTGGGCACAGCTCAGCTGG + Intronic
1000274720 5:159723733-159723755 GGAGCTTCCCAGAACTCAGAAGG + Intergenic
1006976658 6:38108646-38108668 CAGGATGGCCAGAACACAGCAGG - Intronic
1015703329 6:136059911-136059933 CAAGCTTGGCAGAGTTCAGGTGG - Intronic
1018567751 6:165173731-165173753 CCAGGTTGCCAGCTCTCAGCTGG - Intergenic
1022182369 7:27933766-27933788 CAAGCTTGCCAGAACTCAGCAGG - Intronic
1022308394 7:29172244-29172266 CATGCTTTCAAGAACTCAGTGGG - Intronic
1023967495 7:44970520-44970542 CGAGCTTTCCAGAACTAAGTGGG + Intronic
1029261026 7:99302956-99302978 CATGCTTGCCAGACCCCAACAGG - Intergenic
1030064344 7:105647944-105647966 CAATGATTCCAGAACTCAGCTGG + Intronic
1040634100 8:49252420-49252442 CAATATTCCCAGAACCCAGCTGG - Intergenic
1041459238 8:58093531-58093553 CAGGCTTGCCAAAAATCAGATGG + Intronic
1042744776 8:72096061-72096083 GTAGCTTGCCAGCACTCAGTGGG - Intronic
1048858274 8:138702548-138702570 CAAACTTCCCTGAAATCAGCTGG + Intronic
1052494642 9:29212154-29212176 ACAGCTTTCCAGAGCTCAGCCGG + Intergenic
1053677563 9:40450966-40450988 CAATCTGGGCTGAACTCAGCTGG + Intergenic
1053927481 9:43078803-43078825 CAATCTGGGCTGAACTCAGCTGG + Intergenic
1054286158 9:63173945-63173967 CAATCTGGGCTGAACTCAGCTGG - Intergenic
1054290636 9:63286492-63286514 CAATCTGGGCTGAACTCAGCTGG + Intergenic
1054388657 9:64591039-64591061 CAATCTGGGCTGAACTCAGCTGG + Intergenic
1054507059 9:65925332-65925354 CAATCTGGGCTGAACTCAGCTGG - Intergenic
1054818216 9:69496104-69496126 CAAACATGGCAGAACTAAGCTGG + Intronic
1059637776 9:116187515-116187537 GAAGGTGGCCAGGACTCAGCGGG + Exonic
1185505931 X:632202-632224 CAAGGTTGTCAGAGCGCAGCCGG + Intronic
1188359163 X:29231364-29231386 CAAGCTTCAGCGAACTCAGCGGG - Intronic
1189916740 X:45863095-45863117 TAAGCCTGCCAGCTCTCAGCAGG - Intergenic
1190009874 X:46775317-46775339 CAAGCTTGGCTGAACTTGGCTGG + Intergenic
1195304127 X:103562486-103562508 ATGCCTTGCCAGAACTCAGCAGG + Intergenic
1197007232 X:121515817-121515839 TTAGATTGCCAGAACTCAGATGG + Intergenic