ID: 1022185196

View in Genome Browser
Species Human (GRCh38)
Location 7:27960625-27960647
Sequence GTGGTTGCCCTGACAATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022185190_1022185196 23 Left 1022185190 7:27960579-27960601 CCTGGCTGCTGACATATTTTGGA 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1022185196 7:27960625-27960647 GTGGTTGCCCTGACAATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022185196 Original CRISPR GTGGTTGCCCTGACAATTGA GGG Intronic
No off target data available for this crispr