ID: 1022185356

View in Genome Browser
Species Human (GRCh38)
Location 7:27961963-27961985
Sequence TACTCACCACTAGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022185356_1022185361 19 Left 1022185356 7:27961963-27961985 CCCAGCTCCACTAGTGGTGAGTA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1022185361 7:27962005-27962027 CCTTATCTATAAAATGAAGATGG 0: 1
1: 3
2: 33
3: 190
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022185356 Original CRISPR TACTCACCACTAGTGGAGCT GGG (reversed) Intronic
901588870 1:10322314-10322336 TCAACACCACTCGTGGAGCTGGG - Intronic
903579639 1:24361174-24361196 AGCTCACTACCAGTGGAGCTAGG - Intronic
907107975 1:51901333-51901355 GAATCAGGACTAGTGGAGCTTGG - Intergenic
907755222 1:57304362-57304384 TAATCTCCACTACTGGAGGTGGG - Intronic
910437423 1:87219559-87219581 CACTCACTACCAGTGTAGCTGGG - Intergenic
913032433 1:114922625-114922647 TAATCACCAATATTGGAGGTGGG - Intronic
919785880 1:201258635-201258657 TACTCCCCAAAAGTGGAGGTTGG - Intergenic
923144321 1:231187242-231187264 TACTCCCCACTTGGGGAGCCTGG - Intronic
924270736 1:242329874-242329896 TACTCAACACTTGTGAAGCTGGG - Intronic
1065059883 10:21889348-21889370 TAATCACCAGTATTGGAGGTGGG - Intronic
1068902347 10:62282198-62282220 CACTCACCTCTTGAGGAGCTGGG + Intergenic
1083924564 11:65798166-65798188 AACTGACCAGCAGTGGAGCTAGG + Intergenic
1085769070 11:79309100-79309122 CACTCACCACCAGTGGAGGATGG + Intronic
1086438838 11:86807957-86807979 TCCTCAGCAGTAGTGGAGATGGG + Exonic
1087065542 11:94024673-94024695 TCCTAACCACTCATGGAGCTTGG + Intronic
1087174128 11:95080588-95080610 TGCTAATCAATAGTGGAGCTAGG - Intergenic
1090373742 11:126274835-126274857 GACTCCCCACTTGTGGAGTTGGG + Intronic
1093071957 12:14715187-14715209 TAATGACCACTAGTGGAGTTTGG + Intergenic
1093148107 12:15590517-15590539 TACTGACATCTAGTGGTGCTGGG - Intronic
1095262813 12:40116912-40116934 TACTCTCCAGTATTGGAGGTGGG - Intergenic
1099583671 12:84487303-84487325 TACCCAGCACTGTTGGAGCTGGG + Intergenic
1100885446 12:99065088-99065110 TTCACATCACTAGTAGAGCTTGG - Intronic
1101652911 12:106694015-106694037 TACTCCTCAGTAGTGGAGCCAGG + Intronic
1102667923 12:114591978-114592000 GAAGCACCACTAGTAGAGCTGGG + Intergenic
1106822498 13:33481082-33481104 AATTCACCACTAGAGGATCTCGG + Intergenic
1110662396 13:78072466-78072488 TACTCTCCAGTATTGGAGGTGGG - Intergenic
1124665121 15:31585781-31585803 TACAGACCACTATTTGAGCTTGG + Intronic
1125014481 15:34918585-34918607 TACTCATAAGTAGAGGAGCTGGG - Intronic
1134910889 16:18025360-18025382 TTCTCACCAGTGGTGCAGCTGGG + Intergenic
1135435829 16:22426029-22426051 CAGTCACCAATAGTGGAGTTGGG - Intronic
1135921459 16:26652577-26652599 TAATCACCAATATTGGAGTTGGG - Intergenic
1140805117 16:78526172-78526194 GTTTCACCAGTAGTGGAGCTAGG + Intronic
1140888835 16:79268030-79268052 TCCTCCCCTCTAGGGGAGCTGGG + Intergenic
1142888043 17:2925528-2925550 TAATCCCCACGAGTGGAGCGAGG - Intronic
1146422061 17:32696468-32696490 TACTAACTACTAGTTGAGCTTGG - Intronic
1148756563 17:49976148-49976170 TCCTCACCACTCCTGGATCTTGG - Intergenic
1163722207 19:18903639-18903661 TACTCAGCACTCCGGGAGCTGGG - Intronic
1163763188 19:19147922-19147944 TCCTCCCCACTCATGGAGCTGGG - Intronic
1166560264 19:43728175-43728197 TAGTCACCACTGTTGGAGGTGGG + Exonic
1166901400 19:46066799-46066821 TAATCACCAGTATTGGAGGTGGG - Intronic
1168045250 19:53789779-53789801 TACTAAACATTAGTGGAGCATGG - Intergenic
1168194489 19:54763926-54763948 TACTCACCGGTTTTGGAGCTTGG - Intronic
1168196537 19:54778647-54778669 TACTCACCGGTTTTGGAGCTTGG - Exonic
1168202311 19:54825063-54825085 TACTCACCAGATTTGGAGCTTGG - Exonic
1168204898 19:54842903-54842925 TACTCACCGGTTTTGGAGCTTGG - Intronic
1168207117 19:54859114-54859136 TACTCACCAGATTTGGAGCTTGG - Exonic
926956630 2:18308909-18308931 TAATCCCCAGTACTGGAGCTGGG + Intronic
928532791 2:32208956-32208978 TACTCTCAACTAGTGAAGCCTGG + Intronic
943444868 2:187972148-187972170 TAATCACCAATATTGGAGGTAGG - Intergenic
947106926 2:226677212-226677234 TACTCACCTCCAGTGGAGTTTGG + Intergenic
1170253319 20:14311187-14311209 CACTTACCACAAATGGAGCTTGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1176904176 21:14479696-14479718 TACTCTCCACTTGTGAAGCCTGG - Intergenic
1178083744 21:29092566-29092588 TACTCACCCAGAGGGGAGCTGGG - Exonic
1183179189 22:36247127-36247149 TTCTCACCACCAGAGGATCTGGG - Intergenic
953741293 3:45541384-45541406 TACTCACAATTACTGGAGCCAGG - Intronic
955529947 3:59862699-59862721 AAATCACCACTAGTGGAGTGAGG + Intronic
955713554 3:61805012-61805034 TCCTCATCACCAGTGAAGCTGGG - Intronic
962383973 3:134917995-134918017 TGCTCATCAGTTGTGGAGCTGGG + Intronic
962389435 3:134958947-134958969 TGCTCAACACTAGTGGAATTTGG - Intronic
962913489 3:139876918-139876940 CTCTTACCACTAGTGAAGCTAGG - Intergenic
972828068 4:42784815-42784837 TAATAACCACTACTGGAGATGGG + Intergenic
974125335 4:57689460-57689482 ATCTCACAACTAGTAGAGCTGGG + Intergenic
975901828 4:79162457-79162479 TAATCACCATGAGTGCAGCTGGG - Intergenic
986360678 5:6975274-6975296 TAGTCACCAATATTGGAGGTGGG - Intergenic
987595624 5:19994593-19994615 TACTCCTCACTAGTGGTGTTGGG - Intronic
988395984 5:30698517-30698539 TAGCCACCACTAGAGCAGCTGGG - Intergenic
988890504 5:35611482-35611504 TACTGACTAATAGTAGAGCTGGG + Intergenic
990097844 5:52140336-52140358 TAATCCCCACTATTGGAGGTGGG + Intergenic
998398938 5:141837714-141837736 TACTTACCACTTGTGAGGCTTGG + Intergenic
998809807 5:145955060-145955082 TAATCACCAGTACTGGAGGTGGG - Intronic
1000269855 5:159673532-159673554 TAATCCCCAGTATTGGAGCTGGG + Intergenic
1007324957 6:41052925-41052947 CACTCTCCCCCAGTGGAGCTAGG + Intronic
1009951609 6:70403254-70403276 GAATCACCACTTTTGGAGCTGGG + Intergenic
1012541229 6:100364414-100364436 TACTCACCAATGTGGGAGCTAGG + Intergenic
1012785905 6:103625371-103625393 TAATCCCCAGTATTGGAGCTGGG - Intergenic
1022185356 7:27961963-27961985 TACTCACCACTAGTGGAGCTGGG - Intronic
1024708190 7:51984772-51984794 TAATCCCCATTACTGGAGCTGGG - Intergenic
1024962994 7:54996998-54997020 CACTCACCACTCCTGGAGCTGGG - Intergenic
1026876213 7:73880466-73880488 AACTCAACCCTAGTGGAGCTTGG - Intergenic
1036756002 8:11471538-11471560 TACTAATCACCAGAGGAGCTGGG - Intronic
1037281947 8:17251119-17251141 TATTCACCTCTAGTGGAGGCTGG - Intronic
1039156992 8:34571718-34571740 TACTGACCATGAATGGAGCTTGG - Intergenic
1042432955 8:68728907-68728929 TACTCACAAGTAGTGAAGTTTGG + Intronic
1043428983 8:80176149-80176171 TACTTAACACTAATGGAGGTTGG + Intronic
1046730001 8:117714421-117714443 AACTCAGAAGTAGTGGAGCTGGG + Intergenic
1047484976 8:125321107-125321129 TAATCACCAATACTGGAGGTGGG - Intronic
1052135351 9:24902761-24902783 TACTCACTAATAGTAGAGTTGGG + Intergenic
1052701313 9:31941310-31941332 TAGTCACAACTAGAGCAGCTGGG - Intergenic
1057116393 9:92526904-92526926 TACTTACCATGAATGGAGCTTGG - Intronic
1057857921 9:98616390-98616412 TACACAACACAAGTGCAGCTAGG + Intronic
1058035911 9:100252595-100252617 AACTCCCAACAAGTGGAGCTAGG - Intronic
1189094249 X:38121252-38121274 TAATCCCCACTATTGGAGGTGGG - Intronic
1193192192 X:78583861-78583883 TTATCTCCACTAGTGGAGGTGGG + Intergenic
1195077613 X:101342392-101342414 TACTAACCACCAGAGTAGCTTGG + Intergenic
1199462870 X:148102890-148102912 TACTCAGAACTGGTAGAGCTTGG + Intergenic