ID: 1022186262

View in Genome Browser
Species Human (GRCh38)
Location 7:27972413-27972435
Sequence CTCTTTTAGGGGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022186250_1022186262 13 Left 1022186250 7:27972377-27972399 CCTGAGCTGGGTGTGCTCAAGGG 0: 1
1: 0
2: 4
3: 20
4: 190
Right 1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG 0: 1
1: 0
2: 3
3: 43
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022186262 Original CRISPR CTCTTTTAGGGGAAGGAGGA TGG Intronic
901043264 1:6378739-6378761 AACATTTAGGGGGAGGAGGAGGG + Intronic
901634398 1:10663857-10663879 CTCCTCTGGGGGAAGGAGGCAGG + Intronic
901807524 1:11747875-11747897 CTCTTTTAGGGGAGGGGATATGG + Intronic
901810055 1:11762345-11762367 CTCTTTTGGTGGCAAGAGGAGGG + Intronic
902065513 1:13682424-13682446 ATATTTAAGGGGAAGTAGGATGG + Intergenic
902113749 1:14104233-14104255 CTCCTTGCGGGGAAGGAGCAGGG - Intergenic
902168529 1:14592254-14592276 CTCTTGGAGGGGGATGAGGAGGG + Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902929478 1:19720605-19720627 ATCTTTTGGGGGAAGAATGATGG + Intronic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
904287541 1:29461876-29461898 AACTTTCAGGGGAAGGAGGGTGG + Intergenic
906702354 1:47869051-47869073 TTCATTTGGGGGAAGGAGGGAGG - Intronic
906868586 1:49450706-49450728 TTCTTTTAGGAGAAAGATGATGG + Intronic
908073790 1:60491948-60491970 CTCTTTTAGGGCAGGGATGGTGG - Intergenic
908098838 1:60769783-60769805 TTCCTTTAGGGGCAGGAGAATGG + Intergenic
908115736 1:60938233-60938255 CTCTTTTTTGGAAGGGAGGAGGG + Intronic
908179854 1:61592978-61593000 CTTTTTTGGGGGAATGGGGACGG - Intergenic
908321075 1:62979484-62979506 CTACCTTAGGGGATGGAGGATGG - Intergenic
908665755 1:66488197-66488219 TTATTTGAGGGGAAGCAGGATGG - Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909329630 1:74396047-74396069 CTCTTTAAGGGGGAGCATGAGGG - Intronic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
910235842 1:85035716-85035738 ATTTTTTAGGGGAGAGAGGATGG - Intronic
911573356 1:99544513-99544535 CTCTTCTAGGGGAGAGAGAAAGG - Intergenic
912237469 1:107867556-107867578 TTTTTTTAGGCAAAGGAGGAGGG - Intronic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
913996190 1:143653454-143653476 CTCTTTTGGAGAAAGGAGGGAGG - Intergenic
914376628 1:147078468-147078490 CTCTTTTGGAGAAAGGAGGGAGG + Intergenic
914492747 1:148162403-148162425 CTCTTTTGGAGAAAGGAGGGAGG - Intergenic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915036982 1:152936029-152936051 CTCTTTTAAGGAAATCAGGAGGG + Intergenic
915463509 1:156082800-156082822 CTTTTTTATGGAAATGAGGAGGG + Intronic
916513467 1:165494289-165494311 TTTTTGTAGGTGAAGGAGGATGG + Intergenic
916627069 1:166569944-166569966 CTCTTGTAGGAGAAGGCTGAAGG + Intergenic
916879316 1:169004108-169004130 CTCCTCAAGGGTAAGGAGGACGG - Intergenic
918261835 1:182803328-182803350 CCCTTTTAGGGGAAGATTGATGG - Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918815848 1:189181644-189181666 CGCTTTTAGGGGATGGAAGGTGG - Intergenic
919236390 1:194849798-194849820 CTCTTTTAGGGAAAGCAAAAGGG + Intergenic
919798696 1:201337505-201337527 TTCTTTTAGGTGAACAAGGAAGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920856378 1:209665912-209665934 CTCTTCTAGGGGCAGGAAGAAGG + Intergenic
921316114 1:213892862-213892884 CTCTTTTGGGAGAAGGATGGTGG - Intergenic
921655932 1:217737451-217737473 ATCTTTAAGGGAAGGGAGGAGGG + Intronic
922876225 1:228941841-228941863 CTCTTTTGGAAGAATGAGGATGG - Intergenic
924795445 1:247289203-247289225 CTCTTTAAGGGTAATGCGGACGG - Intergenic
924883452 1:248188011-248188033 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883465 1:248188076-248188098 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883479 1:248188142-248188164 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
1063608350 10:7542214-7542236 CTCTGTTTTGGGAAGTAGGACGG - Intergenic
1063744038 10:8859063-8859085 CTCTTTTGGGGGAAAAAAGAGGG - Intergenic
1064019352 10:11796778-11796800 GTCTTTTTGGGGAAGGGGGAAGG + Intergenic
1064551837 10:16509209-16509231 ATCTTTTAGTGTAAGCAGGACGG + Intronic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1067413271 10:46083906-46083928 CTCTTATAGGGGAAAGAACATGG + Intergenic
1067716076 10:48691995-48692017 GTTCTTTAGGAGAAGGAGGAGGG + Intronic
1067974144 10:51005186-51005208 ATCATTTTGGGGGAGGAGGAAGG + Intronic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1068831584 10:61501775-61501797 CTCTTTTTGGGGAAGGATGATGG + Intergenic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1071676021 10:87657099-87657121 CTCATTCAGGGGACAGAGGAAGG - Intergenic
1071963044 10:90824781-90824803 CTCTTCTTGTGGAAGGGGGAGGG + Intronic
1072098318 10:92204649-92204671 CTCTTCTAGTGGAAGGAAAATGG + Intronic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072355612 10:94606999-94607021 TTCTTTTGGGGTGAGGAGGAGGG + Intronic
1073306755 10:102508945-102508967 GTCTTTCAGGGGTAGGAGAAGGG + Intronic
1073635958 10:105199395-105199417 TTCTTTTTAAGGAAGGAGGAGGG + Intronic
1073713593 10:106075083-106075105 TTCATTTATGGGAAGGAGGAAGG + Intergenic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074858328 10:117490013-117490035 CTCTTGGAGGGGAGGCAGGAAGG + Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077662679 11:4083508-4083530 CTCTTTGCGGGGATGAAGGAAGG + Intronic
1078475585 11:11626384-11626406 CTCTTTGAGGGCAGGGATGAGGG - Intergenic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1080286528 11:30620551-30620573 TTCTTTTTGGGGATGGAGGCAGG + Intergenic
1082734257 11:56838798-56838820 CTCTGTTAGGGCAATGTGGAAGG - Intergenic
1082782327 11:57297609-57297631 GTCCTTTAGGGGTGGGAGGAGGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1084292105 11:68179295-68179317 TTCTATTAAGGGAGGGAGGACGG - Intronic
1085481087 11:76823604-76823626 CCCTTTCAGGAGAAGGAGGTGGG + Intergenic
1085987359 11:81802729-81802751 CTCATTGTGGGGAAGGAGGTTGG - Intergenic
1086669926 11:89533868-89533890 CTGTTTCAGGGGAAGGATGTGGG - Intergenic
1086858418 11:91895438-91895460 TTCTTTTGGGAGACGGAGGATGG + Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089571233 11:119411765-119411787 CTCATGTAGTGGAAGGAGTATGG + Intergenic
1092322031 12:7486620-7486642 CTCATTTTGGGGAAGGAACAGGG - Exonic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1092966370 12:13647618-13647640 CTCTTTCAGGGGTAAGAGGTGGG - Intronic
1093356511 12:18173842-18173864 CTCCTCTAGGGGAAGGGGGAGGG + Intronic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095994638 12:48070489-48070511 CTACTTGAGGGGAAGGATGAAGG - Intronic
1097057089 12:56256857-56256879 CAGTTCTAGGGGTAGGAGGAAGG + Intronic
1097085781 12:56467248-56467270 TTTTTTGAGGGGTAGGAGGATGG + Intronic
1097961101 12:65532720-65532742 GCCATTTAGGGGTAGGAGGAAGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100956462 12:99914674-99914696 CTCTGATAGGGAAAGGGGGAGGG + Intronic
1101172062 12:102107893-102107915 GCCTTTAAGGGGAAGGAAGAAGG + Intronic
1101626417 12:106447248-106447270 CTCTTGTAGGGGGAGTGGGAGGG - Intronic
1101856967 12:108451873-108451895 CTCTTTGGTGGGAAAGAGGAGGG - Intergenic
1101875017 12:108591977-108591999 TTCTTCTTGGGGAAGGACGATGG + Exonic
1102214405 12:111150298-111150320 CTTTTTTGGGGGGAGGAGGAAGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1104381617 12:128312527-128312549 GTCTTTTACGGGAAGGGAGAGGG + Intronic
1104917841 12:132275202-132275224 ATGTTTTATGGGAAGGAGGAGGG - Intronic
1105387383 13:19943949-19943971 CTGTTTGAGGGGAATGAGAAGGG + Intergenic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107791177 13:44003854-44003876 CTCACATAGTGGAAGGAGGAAGG - Intergenic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1108161463 13:47644717-47644739 CTCATATGGTGGAAGGAGGAAGG - Intergenic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1110253865 13:73410077-73410099 CTCTTGGAGGGTAAGGTGGACGG + Intergenic
1111107819 13:83669467-83669489 CTCTTCTAGGGTCTGGAGGATGG - Intergenic
1111421649 13:88019055-88019077 CTCTGTTAGGGCAGTGAGGAAGG + Intergenic
1112561830 13:100521980-100522002 CCCTTTTTGGGGAAGAAGGGTGG - Intronic
1112760991 13:102692946-102692968 CTGGTTTAGAGGCAGGAGGAAGG + Intronic
1112798967 13:103089453-103089475 CTTTTTTTGGGGGAGGGGGAGGG - Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114473514 14:22979496-22979518 CCCTACTAGGGGCAGGAGGAGGG + Intronic
1116527232 14:45919965-45919987 CTATTTTAAAGGAAGGAGCAGGG + Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118942013 14:70347076-70347098 CTCTTTAAGGGTAATGCGGACGG - Intronic
1119114219 14:72003701-72003723 CACTTCTAGGGGATGGGGGAAGG + Intronic
1119996682 14:79261340-79261362 CTCCTGTAAGGGAAGGAGAAAGG + Intronic
1120049830 14:79852365-79852387 CCAGTTTAGGGGTAGGAGGAAGG - Intronic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1126909705 15:53404693-53404715 CTCTCTTTGGGGAAAGAGGACGG + Intergenic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1129827062 15:78641051-78641073 TTCTTTTCGGGGAAGGAGGGAGG - Intronic
1130645773 15:85725375-85725397 CTTTTTTGGGGGGAGGGGGAGGG + Intronic
1131577258 15:93604414-93604436 CTCTTTTTGGGGAGGTGGGAAGG - Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133483798 16:6198115-6198137 GACTTTTGGGGGAAGGATGAGGG + Intronic
1133526031 16:6606513-6606535 CTCGTAGAGGGGAAGGAGGAGGG - Intronic
1134067571 16:11238941-11238963 CTCATATAGCGGAAGGAGGAGGG + Intergenic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1136511427 16:30740028-30740050 CACCCTTAGGGGAAGGGGGAGGG + Exonic
1136621259 16:31430167-31430189 CACTTTTGGGAGAATGAGGAGGG + Intergenic
1137709078 16:50554096-50554118 TTCTTCTTGGGGAAGGAGGCTGG + Intronic
1137844051 16:51669504-51669526 CTCTTATTGGGGAAGGAGGGAGG + Intergenic
1138378176 16:56581410-56581432 CTCTTTTAAGCCAAGCAGGATGG + Intergenic
1138378431 16:56583252-56583274 CTCTTTTAAGCCAAGCAGGATGG + Intergenic
1138741551 16:59316704-59316726 CTCTTGTATGGAGAGGAGGAAGG + Intergenic
1139801491 16:69526604-69526626 TTCTTTCAGGTGAAAGAGGAGGG - Intergenic
1139853973 16:69966203-69966225 ATCTATTAGGGGAGTGAGGAAGG + Intergenic
1139882952 16:70189116-70189138 ATCTATTAGGGGAGTGAGGAAGG + Intergenic
1140343575 16:74189871-74189893 TTCCTTTAGAGGAGGGAGGAAGG + Intergenic
1140369557 16:74406403-74406425 ATCTATTAGGGGAGTGAGGAAGG - Intergenic
1141233034 16:82188468-82188490 CTCTTTTGGGGGAATAAGGATGG + Intergenic
1141349863 16:83284542-83284564 ATTTTTTAGTGGAAGGAGGGAGG + Intronic
1141823705 16:86464779-86464801 CTCCTTTAGGGAAGTGAGGAAGG - Intergenic
1141842453 16:86582240-86582262 CTCTTTTTGGTTCAGGAGGAAGG - Intergenic
1142063642 16:88047404-88047426 CTGGTTTGGGGGAAGGAGCAAGG - Intronic
1142106895 16:88309183-88309205 ACCTCTCAGGGGAAGGAGGAAGG + Intergenic
1146064699 17:29625035-29625057 CTCTTTAAAGAGAAGGAGGGTGG - Intergenic
1146922863 17:36725099-36725121 CAATTTTAGGGGAACGGGGAGGG + Intergenic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147887732 17:43696055-43696077 CTCTCTTAGGGAAAGGGGAAGGG - Intergenic
1148104502 17:45112222-45112244 CTCCTCTGGGGGAAGGAGGCTGG + Exonic
1148460568 17:47837015-47837037 CTCTTTCTGGGGAAGGAAGGGGG + Exonic
1148714938 17:49709107-49709129 GTCTTTTAGAGGGAGGAGTAAGG + Intergenic
1148756408 17:49975376-49975398 CTCACCTTGGGGAAGGAGGAGGG + Intergenic
1149380443 17:56088289-56088311 CAATTTTAGAGGAATGAGGAGGG + Intergenic
1149394891 17:56230339-56230361 ATCTTTTTGGGGAAGGAGAGAGG + Intronic
1149571987 17:57678578-57678600 CTCTTCCAGGGGAGGGAGGGAGG - Intronic
1150205131 17:63398515-63398537 CTTTTTTATAGGGAGGAGGAAGG + Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1153070088 18:1095670-1095692 CTCTGGTAGGGGACTGAGGAAGG + Intergenic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153460728 18:5329821-5329843 CTCTTAGATGGGAAGGAGGAAGG + Intergenic
1157865036 18:51175431-51175453 GTAATTTAGGGGAGGGAGGAGGG - Exonic
1158332404 18:56376846-56376868 CTCTTTTCAGGGTAGAAGGATGG + Intergenic
1159492746 18:69159567-69159589 TGTTTTTAGGGGAAGGAGGAGGG - Intergenic
1159580730 18:70232051-70232073 CTCTTTGAGGCCAAGGTGGAAGG - Intergenic
1159684238 18:71397170-71397192 CTCTTTTGGGGAAAGAATGAGGG + Intergenic
1160440690 18:78889203-78889225 CTACTTGAGGGGAAGGAGGGAGG + Intergenic
1160611208 18:80086799-80086821 ATCTTCTAGGAGAAGCAGGATGG - Intronic
1161197242 19:2993720-2993742 CTCTTATAGTGGAATGAGGGAGG + Intronic
1163821181 19:19497502-19497524 GGCTCTGAGGGGAAGGAGGAGGG + Intronic
1165660042 19:37570105-37570127 GTCTTTTAGGGGAGGGTGGGTGG - Intronic
1167197342 19:48039406-48039428 CTCTTATAGGGCAGGGAGAAGGG - Intronic
1167766814 19:51488779-51488801 TGCTCTTAGGGGAATGAGGAGGG - Intronic
1168284350 19:55322996-55323018 TGCATTTTGGGGAAGGAGGAAGG - Intronic
1168336240 19:55599302-55599324 ACCTTTTAGGGGCAGGGGGAGGG - Intronic
925266476 2:2569946-2569968 CTATTTTCCTGGAAGGAGGAAGG + Intergenic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
926695503 2:15767727-15767749 CCATGTTAGGGGAAGGAGGGTGG - Intergenic
928429200 2:31204020-31204042 CTGTTTTGGGGGTAGGAGGTTGG + Intronic
928538467 2:32262278-32262300 CCCTTTTTGGGGAAGTAGAAAGG - Intronic
929597482 2:43185480-43185502 AACTCTTAGGGGGAGGAGGAGGG + Intergenic
929625765 2:43405069-43405091 CATTTAGAGGGGAAGGAGGAGGG - Intronic
929652743 2:43698096-43698118 CTCTTCTGGGGGAAGGAAGTTGG - Intronic
929659372 2:43768804-43768826 TTCTTTTAGGGAAAAGAGAATGG - Intergenic
929728269 2:44456559-44456581 CTCTTTTAGGGGAAGCAACCAGG + Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930865723 2:56120430-56120452 CTTTTGGAAGGGAAGGAGGAGGG - Intergenic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931021961 2:58056085-58056107 CTCTTTTAGGGGGTGGGGGAGGG - Intronic
931122922 2:59240545-59240567 CTTTTCTAGAGGCAGGAGGATGG - Intergenic
931589950 2:63871825-63871847 CTATTTTAGGAGAAGAAGCATGG + Intronic
932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
934487373 2:94728253-94728275 GTCTTTCAGGGGAAGAAGAATGG - Intergenic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935584720 2:104790375-104790397 CTCTCCTGGGGGCAGGAGGAGGG - Intergenic
935889499 2:107660786-107660808 CTCCCTTAGGGGAGGTAGGAAGG + Intergenic
938051514 2:128176715-128176737 CTCCTTTATGAGAAGGATGATGG + Intronic
939183578 2:138832559-138832581 CTAATTTAGGGAAAGAAGGAAGG - Intergenic
940843172 2:158608580-158608602 TCCTTTGAGGGGAAGGAGGAAGG + Intronic
941125364 2:161578214-161578236 CTCTAGTAGTGGAAGGAGGGAGG + Intronic
942818523 2:180081778-180081800 GTCTTTTGGGGGAAGATGGATGG - Intergenic
943605998 2:189977296-189977318 CTCTATTAGGGCAAGGAGAGTGG - Intronic
943923030 2:193734613-193734635 CTCTTTTACGGGATTCAGGAGGG + Intergenic
944821707 2:203439469-203439491 CTCTTTTGGGGGGAGCAGGAGGG + Exonic
944889469 2:204102377-204102399 CTATTTTAGGGGAGGAAGGGTGG + Intergenic
944983021 2:205143956-205143978 CATTTTTAGGGGGAGGAGGGTGG - Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945190523 2:207182864-207182886 CACACTTAGGGGAATGAGGAGGG + Intergenic
945579310 2:211572901-211572923 ATCTTTCATGGGTAGGAGGAGGG - Intronic
946348930 2:219135202-219135224 TTCTACTAGGGGAAAGAGGAGGG + Intronic
946968660 2:225067639-225067661 CTCTGTTAGGGCAGTGAGGAAGG + Intergenic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948200890 2:236129074-236129096 AGCTTTTTGGGGAAGGATGAGGG - Exonic
1168938301 20:1686827-1686849 CTCAGTTCGGGGCAGGAGGAGGG + Intergenic
1169000491 20:2164517-2164539 CACATTTGGGGGAAGCAGGAAGG - Intronic
1169136429 20:3200523-3200545 CCCTGTTAGGGGAGGGACGAGGG - Intronic
1169801300 20:9515046-9515068 TTCTTTTAGGGGAGGAGGGAGGG + Intronic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170904144 20:20497062-20497084 CTTTTATGTGGGAAGGAGGAAGG - Intronic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172565719 20:35928823-35928845 GCCCTTGAGGGGAAGGAGGAAGG + Intronic
1173099717 20:40074371-40074393 GTCTTTTAAGAGAAAGAGGAAGG - Intergenic
1173111278 20:40192777-40192799 CTCTTTCATGGGTAGGAGGTGGG - Intergenic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174962492 20:55174112-55174134 CCCCTTTGGGGGAAGGGGGAAGG + Intergenic
1175395650 20:58658829-58658851 TTCTTTTAAGGGGAGGGGGAAGG - Intronic
1175453973 20:59095737-59095759 CTCTTATGGGGGAAGGTAGAAGG - Intergenic
1176019719 20:62956451-62956473 CTCTTTGAGGGGAACAAGCAGGG + Intronic
1177743019 21:25176566-25176588 CTCTATTAGGGAAAGAATGAAGG - Intergenic
1177762682 21:25419723-25419745 CTTTGTTAGAGGAAGCAGGATGG - Intergenic
1178486262 21:33021568-33021590 CCCCTTTAGGGCTAGGAGGAAGG - Intergenic
1178981312 21:37267469-37267491 CTCTTGTGCCGGAAGGAGGAAGG - Exonic
1182130723 22:27848527-27848549 TACATTTTGGGGAAGGAGGAAGG + Intergenic
1182151791 22:28032734-28032756 GCCTTTTAGGGGGAGGGGGAGGG - Intronic
1183173911 22:36208370-36208392 TTCCTTTAGGGGAAACAGGATGG - Intergenic
1184583189 22:45430659-45430681 TGCCTTTAGGAGAAGGAGGACGG + Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950306814 3:11921634-11921656 CTCTTTTAGGTGAGACAGGAAGG + Intergenic
950994786 3:17483305-17483327 CTTTTTTAGGGGAGGAAGTATGG - Intronic
951619922 3:24589714-24589736 CACTTTAGGGGGAAGGAGCAGGG + Intergenic
951832799 3:26949312-26949334 ATCTTTTAGAGGAGGTAGGAGGG - Intergenic
951969170 3:28423846-28423868 CTATTTGAGAGGAAGGAGGGTGG - Intronic
952557781 3:34552946-34552968 TGCCTTTTGGGGAAGGAGGAAGG - Intergenic
953286200 3:41612275-41612297 GTATTTTGAGGGAAGGAGGAGGG - Intronic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
956499476 3:69866407-69866429 CTCTTTAAGGGGGAGGATAAAGG + Intronic
956536242 3:70280222-70280244 CTTTTTAAGGGAGAGGAGGAGGG - Intergenic
957224891 3:77430643-77430665 CTCCTGTAGTGGAAGGAGCAAGG - Intronic
957433052 3:80138668-80138690 GTCTTTTATGGGAACGTGGATGG + Intergenic
959326739 3:104946321-104946343 GTCTTTTAAGGGAACGTGGATGG - Intergenic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
960217982 3:115066242-115066264 CTATTTTAGGAGTAGGAGGTTGG - Intronic
961558739 3:127714402-127714424 CTCCTTTAGGGGAGCGAGGGTGG - Intronic
962074746 3:132069995-132070017 CTCATTTTGGGGAAGAAAGAGGG - Intronic
962364291 3:134767331-134767353 GTCTTTTAGTTGAAGGGGGAAGG - Intronic
964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG + Intergenic
964618916 3:158700896-158700918 CCCTTTTGGGGGAAGCAGGGTGG - Intronic
965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
966182521 3:177199637-177199659 GTCATTTAGGGGAAGGAGAAGGG - Intergenic
969063650 4:4460082-4460104 ATCTTTACGGGGAAGGAAGAAGG - Intronic
969957495 4:10906237-10906259 CTTTTTCAGGGGTAGAAGGATGG - Intergenic
970138246 4:12950306-12950328 TTGTTTTATGGGAGGGAGGAGGG + Intergenic
970831699 4:20347235-20347257 CTCTGTTAGGTAAAGGAGGCAGG + Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
972549962 4:40123106-40123128 CCCTTGTGGGGGAAGGGGGAGGG - Exonic
973340653 4:48999994-49000016 CCTTTTAAGGGAAAGGAGGAGGG - Intronic
973842565 4:54876904-54876926 CTCTTTATGGGGTAGGAGGTGGG - Intergenic
973894360 4:55396577-55396599 CTCCTTTAGGGAAAGGGAGAGGG + Intronic
974292168 4:59947411-59947433 CATTTTCTGGGGAAGGAGGAGGG - Intergenic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
974633892 4:64533455-64533477 CCCTTTCAGGGGAAGTGGGATGG - Intergenic
976000759 4:80370942-80370964 CTCTTCTAGGGCAGTGAGGAAGG - Intronic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
976913880 4:90345055-90345077 CTCTTTTAATGGAAAGAGCATGG - Intronic
977549932 4:98430179-98430201 CCCTTTTAGGAAAAGGTGGATGG + Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
978738436 4:112110583-112110605 CTCTTGTTGGGGAAGGTGGGAGG + Intergenic
978765716 4:112403041-112403063 CTTTTTTAGGGGGTGGGGGAGGG + Intronic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
979832928 4:125322675-125322697 CTTTTTTGGGGGGAGGAGGTGGG + Intronic
979878340 4:125922625-125922647 GTCTTTTATGGGAACGTGGATGG - Intergenic
979906514 4:126300476-126300498 CTCTTCTAGGGCAATGTGGAAGG - Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
980586018 4:134817065-134817087 CTCTTCTAGGGCAATGTGGAAGG - Intergenic
980987519 4:139710092-139710114 TTCTTTTAGGGGTTGGAGGTGGG + Intronic
981642225 4:146957718-146957740 GGCTTTTAGGGGAAGGAGTAAGG + Intergenic
982504915 4:156205455-156205477 CTCTGTTAGGGAAATGCGGAAGG - Intergenic
982675095 4:158366722-158366744 CTCTTTTAGGGGAGGCCTGATGG + Intronic
982681158 4:158432582-158432604 CTCTTTTAGGGGAGGCCTGATGG - Intronic
983465803 4:168087896-168087918 ATCTTTCATTGGAAGGAGGACGG + Intergenic
985631596 5:1016960-1016982 ATCCTTTGTGGGAAGGAGGATGG - Intronic
985631605 5:1016996-1017018 ATCCTTTGTGGGAAGGAGGATGG - Intronic
986448817 5:7846993-7847015 CTATTTTAGGAGACTGAGGAGGG - Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986759780 5:10869371-10869393 CTATTTTAGGGAAAGGTGGATGG + Intergenic
987417147 5:17674254-17674276 CTCATGTGGAGGAAGGAGGAAGG + Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988846081 5:35129768-35129790 CACTTTTAGGGAAAGTGGGAAGG - Intronic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
990169475 5:53031790-53031812 CTCTTTTCGGTGTAGGCGGAGGG + Intronic
990185153 5:53203441-53203463 CTCTTTAAGGGTAATGCGGACGG - Intergenic
992130596 5:73688629-73688651 TTCTTTTTGGGGAGAGAGGAGGG + Intronic
993215858 5:85021789-85021811 CTCTTGTAGGGCAATGTGGAAGG - Intergenic
993225941 5:85167335-85167357 CTCTTCTAGGGCAGTGAGGAAGG + Intergenic
993741454 5:91545826-91545848 GTCTTTCAGGGGGTGGAGGATGG - Intergenic
995598194 5:113768992-113769014 CTGCTTTAGGGGAAGAGGGAAGG + Intergenic
995758269 5:115536058-115536080 CAGTTTCAGGGGAATGAGGAGGG + Intronic
996756905 5:126945257-126945279 CTCTCTGGGGGAAAGGAGGAGGG - Intronic
997474965 5:134137547-134137569 CTGATTTAGGGGATTGAGGAGGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
999707620 5:154288070-154288092 TTCTTTGAGAGGAAGGTGGAGGG + Intronic
999719096 5:154385495-154385517 AGCTTTTGGGGTAAGGAGGATGG - Intronic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1003516391 6:6822337-6822359 GTCTTTTGGGGGAAAGGGGATGG - Intergenic
1003573162 6:7269141-7269163 CTCTTTCAGACGCAGGAGGAGGG - Intronic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1004051078 6:12080081-12080103 CTGTTTTAGGGGATGTAGAAAGG + Intronic
1005341193 6:24845340-24845362 ATCTTTTAGGGGAGGGATGAAGG + Intronic
1005816393 6:29556138-29556160 CACTTTCAGGGTAAGGTGGATGG + Exonic
1006305472 6:33215770-33215792 CTATATTAGGGGGAGGAGAAGGG - Intergenic
1006784499 6:36656662-36656684 CTCCTTCAGGGAAAGGAGGTAGG + Intergenic
1007022736 6:38538623-38538645 CTCTTTTGGGGGGCGGGGGAAGG - Intronic
1007367955 6:41407716-41407738 ACCTTTTAGGGGAGGGAGGGAGG + Intergenic
1007714101 6:43844413-43844435 CTATTGTATGGGAAGAAGGAAGG + Intergenic
1008951335 6:57163122-57163144 CTCTTTTGGGGTGATGAGGAGGG - Intronic
1009900991 6:69807747-69807769 CTCTGCTAGGGGAATGCGGAAGG - Intergenic
1010332211 6:74636438-74636460 CTCTTTAAGGGAAAGAAGTAAGG - Intergenic
1010631796 6:78207442-78207464 CTCTGCTAGGGCAATGAGGAAGG - Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012033224 6:94099586-94099608 CTCTTTTAGGGGAATTTGGAGGG - Intergenic
1012998570 6:105997637-105997659 CTTTTTTAAGGGAAGTAGGTTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1013910716 6:115272765-115272787 CTCTATTAGGGCAATGAAGAGGG + Intergenic
1013948962 6:115756262-115756284 TTCAATTTGGGGAAGGAGGAAGG + Intergenic
1014143001 6:117965544-117965566 ATCCTTTTGGGGAGGGAGGACGG - Intronic
1014398714 6:120960116-120960138 CTCTTTCAGAGGAAAGAGAATGG - Intergenic
1015219945 6:130793256-130793278 CTTTTTCAGGGCAAGGAAGAAGG + Intergenic
1015377595 6:132528084-132528106 CTCTTTTTTGGGTAGGGGGACGG + Intergenic
1015984246 6:138869809-138869831 GTCTTTCAGGGGGAGGAAGAAGG - Intronic
1016035219 6:139376811-139376833 CTCCTTTAAGGGATGGGGGATGG - Intergenic
1016412164 6:143794966-143794988 CTCCTTTCTGTGAAGGAGGAAGG + Intronic
1017231378 6:152077392-152077414 CTCTGCTAGGGCAATGAGGAAGG + Intronic
1017387721 6:153905634-153905656 ATCTTTTGGGGGAAGATGGATGG + Intergenic
1017690166 6:156956155-156956177 CTCTAGCAGGGGAAGGAGGTGGG + Intronic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019515234 7:1436947-1436969 CTCTTTTGGAGGAAGAAGGTGGG + Intronic
1020070765 7:5225553-5225575 CACTTTTAGCTGAAGTAGGATGG - Intronic
1020738006 7:11976200-11976222 ATCTACTATGGGAAGGAGGAAGG - Intergenic
1020936623 7:14473471-14473493 CTCTGCTAGGGCAATGAGGAAGG + Intronic
1021277443 7:18671027-18671049 AACTTTTAGGGGAAGGAGAAAGG + Intronic
1022003368 7:26246050-26246072 CTCTTTAAGGGTAATGCGGATGG - Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1023634243 7:42193938-42193960 CGTTTTCAGGGGACGGAGGAGGG - Intronic
1024586727 7:50848781-50848803 ATATTTTAGGGGGTGGAGGACGG + Intergenic
1024757811 7:52556898-52556920 CTCTTTTAGCTGAAAGAGAATGG + Intergenic
1025015637 7:55436895-55436917 CTCTTGTACAGTAAGGAGGAGGG - Intronic
1025111878 7:56223916-56223938 CTTTTTGAGGGGAATGAGGTGGG + Intergenic
1026218122 7:68367688-68367710 CTCTTCTAGGGAAGGGAGGGAGG - Intergenic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1027180577 7:75936570-75936592 CTCATTTCGGTAAAGGAGGAGGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1030713903 7:112787374-112787396 CTTTTTTGGGGGGAGGGGGAAGG + Intronic
1031329467 7:120446747-120446769 TTGTTATAGGGGAAGGCGGATGG + Intronic
1032810747 7:135413953-135413975 TACTGTTAGTGGAAGGAGGATGG - Intronic
1033555990 7:142488857-142488879 CTCTTTGATGGGAAGGAAGGAGG - Intergenic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034368623 7:150574092-150574114 ATCTTCTAGGGAAAGGGGGAAGG - Intergenic
1035112386 7:156493993-156494015 TGCTTTCATGGGAAGGAGGAAGG - Intergenic
1035587478 8:786944-786966 CTCTTTCAGGTGAAGGCAGAAGG + Intergenic
1035907434 8:3528396-3528418 CACTCGTGGGGGAAGGAGGATGG + Intronic
1035973788 8:4284372-4284394 CTCTTTTTGGGGAGGGTGGGTGG - Intronic
1036285584 8:7442114-7442136 CCCCTTTAGAGGAAGAAGGATGG + Intergenic
1036335889 8:7869415-7869437 CCCCTTTAGAGGAAGAAGGATGG - Intergenic
1038024369 8:23575835-23575857 CTCTTTTGGAGGTGGGAGGAGGG + Intergenic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1038608222 8:29032264-29032286 CTTTTTTGGGGGTGGGAGGAGGG + Intronic
1038885170 8:31655430-31655452 TTCTGTTAGGGTAGGGAGGAGGG + Intronic
1041153290 8:54958060-54958082 CTCTTGAAGGGAAAGGAGGATGG - Intergenic
1041734468 8:61095269-61095291 GTTTTTTAGGGGCAGGAGGTAGG + Intronic
1042158145 8:65866265-65866287 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042352319 8:67789809-67789831 CACTTTTCTGGGAGGGAGGAGGG + Intergenic
1043495099 8:80791772-80791794 CTCATTTTCTGGAAGGAGGAAGG + Intronic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1046355526 8:113080050-113080072 CTCTCTTAGGGGAAGGACAGAGG + Intronic
1047444519 8:124907316-124907338 CTCCCTTAGGGGAAGGGGAACGG + Intergenic
1047528445 8:125654114-125654136 CTCTGGTAGGGGAGTGAGGAAGG + Intergenic
1047559101 8:125966954-125966976 CTCTTGTGGGTGAAGGACGAAGG - Intergenic
1047751217 8:127882156-127882178 CTCATTCAGGGGAGGGGGGATGG - Intergenic
1047965460 8:130042973-130042995 CTCTTTTAGGGCAATGGAGAGGG - Intergenic
1048010747 8:130453738-130453760 CCATTTCAGGGGAATGAGGAAGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049065942 8:140313962-140313984 ATCCTTTAGGAGAAGGTGGATGG - Intronic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049505559 8:142994639-142994661 CAGTTTTAGGGGAAGGAGTTGGG + Intergenic
1050091404 9:2018171-2018193 ATTTTTTAAGGGAATGAGGAAGG + Intronic
1050880517 9:10694146-10694168 CTCTTTTAGTTGAAAGAGCATGG + Intergenic
1050945420 9:11511061-11511083 CTCTCTTAGGGCAATGTGGAAGG + Intergenic
1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
1051108544 9:13608478-13608500 CCCTTTTGGGGGAAGGGGTAGGG - Intergenic
1051323836 9:15942440-15942462 CTTTCTTAAGGGAAGGAGAAAGG + Intronic
1051509147 9:17858153-17858175 TTATTTTAGGGGATGGAGGTGGG + Intergenic
1052625348 9:30968459-30968481 GTCTTTAATGGAAAGGAGGAAGG + Intergenic
1052796893 9:32931285-32931307 CCCTCTGATGGGAAGGAGGAGGG - Intergenic
1053670434 9:40356177-40356199 GTCTTTCAGGGGAAGAAGAATGG + Intergenic
1053920222 9:42982440-42982462 GTCTTTCAGGGGAAGAAGAATGG + Intergenic
1054381552 9:64496161-64496183 GTCTTTCAGGGGAAGAAGAATGG + Intergenic
1054514179 9:66020123-66020145 GTCTTTCAGGGGAAGAAGAATGG - Intergenic
1055794088 9:79955423-79955445 CTCTGTTAGGGGAACGCAGAAGG + Intergenic
1057303290 9:93898748-93898770 CTCTTCTAGGGGAAGAAGGAGGG + Intergenic
1057544948 9:96011475-96011497 CTCATTTAGGGAAAGGAGCAGGG + Intronic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1060933576 9:127503588-127503610 CTCTTCTCGGGGAAGGAGCCAGG + Intergenic
1062085257 9:134644977-134644999 CTCTTTTATGGGGAGAGGGAGGG - Intronic
1062088419 9:134661017-134661039 TTCTTTTAGGGGAGGATGGAAGG + Intronic
1062460924 9:136662273-136662295 CTCTTTTAGGGGAGAGAGCTTGG + Intronic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1186234075 X:7488253-7488275 CTCTTTTGGGGAGAAGAGGAGGG + Intergenic
1186274317 X:7923262-7923284 TTCTTGTAAGGGAAGGAGGGAGG + Intronic
1186569433 X:10698762-10698784 GCCTTTACGGGGAAGGAGGAAGG - Intronic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1186652569 X:11577039-11577061 CTCTCATAGGTGAAGGAGGGAGG - Intronic
1187181285 X:16946368-16946390 CTCTTTTCGGGGAGCGGGGAAGG - Intergenic
1187817733 X:23251056-23251078 TCCTTTTAGGCAAAGGAGGATGG - Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1191877740 X:65813199-65813221 CTCTTTCAGGGCAGTGAGGAAGG + Intergenic
1192054182 X:67756612-67756634 CTGTTTTAAGGGAGGAAGGAAGG - Intergenic
1192195885 X:69027929-69027951 GTCTCATAGGGGTAGGAGGAGGG - Intergenic
1192195977 X:69028486-69028508 CTCTCTTAGGGCAAGAAGGATGG - Intergenic
1192815002 X:74580975-74580997 TTTTTTTAAGGGAAGGAGAAAGG + Intergenic
1194143225 X:90231162-90231184 CTCTGTTATGGGAATGAGAAAGG + Intergenic
1194702719 X:97134115-97134137 CAGTTTTAGGTGAAGGATGAAGG + Intronic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195322093 X:103728526-103728548 GTCTTGGAGGGGAGGGAGGAGGG + Exonic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1200051821 X:153436845-153436867 TTTTTTTAGGGGGAGGAGGGAGG - Intergenic
1200488977 Y:3800484-3800506 CTCTGTTACGGGAATGAGAAAGG + Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic
1201423910 Y:13828718-13828740 CTTTTTTGGGGGAGGGGGGAGGG + Intergenic