ID: 1022194775

View in Genome Browser
Species Human (GRCh38)
Location 7:28054336-28054358
Sequence CAGTTGTTATAAAGGACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022194775_1022194780 25 Left 1022194775 7:28054336-28054358 CCAGTTGTCCTTTATAACAACTG 0: 1
1: 0
2: 3
3: 7
4: 153
Right 1022194780 7:28054384-28054406 GGCAAGGCAGTCACCAGCACTGG No data
1022194775_1022194779 9 Left 1022194775 7:28054336-28054358 CCAGTTGTCCTTTATAACAACTG 0: 1
1: 0
2: 3
3: 7
4: 153
Right 1022194779 7:28054368-28054390 TATTCAACTAGTGTATGGCAAGG No data
1022194775_1022194778 4 Left 1022194775 7:28054336-28054358 CCAGTTGTCCTTTATAACAACTG 0: 1
1: 0
2: 3
3: 7
4: 153
Right 1022194778 7:28054363-28054385 ATGGATATTCAACTAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022194775 Original CRISPR CAGTTGTTATAAAGGACAAC TGG (reversed) Intronic
906138315 1:43516413-43516435 CACTTTTTAAAAAAGACAACAGG - Intergenic
906836329 1:49086496-49086518 CAGTTGTTTCCTAGGACAACGGG - Intronic
907741591 1:57171381-57171403 CAGGAGTTATCAAGGAGAACAGG - Intronic
908957740 1:69654971-69654993 CAGTTATGATGAATGACAACAGG - Intronic
912442180 1:109707649-109707671 CATTTGTCTTAAAGGACAAAGGG - Intronic
914944328 1:152050727-152050749 CAGTTGGTATAGGGGACTACTGG + Intergenic
916009168 1:160689071-160689093 CATTTGTTTTAAAGGAGAAAGGG + Intronic
916321306 1:163507518-163507540 CAGTAGTAACAAATGACAACAGG + Intergenic
916412847 1:164563495-164563517 CAGTTATTATCAAGCACTACTGG + Intronic
917786205 1:178460416-178460438 AAAATGTTATAAATGACAACTGG - Intronic
920696954 1:208188189-208188211 CAGTAGGTGTAAAGGACAATAGG - Intronic
921248989 1:213278759-213278781 CAAGTGTTATAAAGTACAACTGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
924879991 1:248150531-248150553 CAGTAGTTAAAAAAGACAAAAGG - Intergenic
1069162525 10:65108947-65108969 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1071791763 10:88962249-88962271 CATTTTTAAAAAAGGACAACAGG + Intronic
1075767126 10:124902113-124902135 CAGTTGTTATACAGTATAAGTGG + Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1078839531 11:15065486-15065508 CATTTGTTTTAAAGGAGAAAGGG + Intronic
1082299617 11:50490343-50490365 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1086127763 11:83366990-83367012 CAGTTGTTATAGAGAAAAATTGG - Intergenic
1086391595 11:86370555-86370577 GTGTTGTTGTAAAGGACTACCGG - Intergenic
1088416597 11:109596287-109596309 CAGTTATTAAGAAGGACAAACGG - Intergenic
1089051072 11:115546523-115546545 CAGTTTTTATAATGGGCAATGGG - Intergenic
1090217251 11:124980347-124980369 CAGATGTTATAAAGAAGAACTGG - Intronic
1094865415 12:34525181-34525203 CAGTTCCTATAAAAGAAAACAGG + Intergenic
1099555334 12:84102786-84102808 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1099555665 12:84106022-84106044 CAGTTACTATAAAAGAAAACAGG - Intergenic
1100033644 12:90224084-90224106 CAGTAGTTATCAAGGGCAAAGGG + Intergenic
1100550630 12:95643677-95643699 CAGTTGTTATAAACCACAACAGG + Intergenic
1100558696 12:95724577-95724599 TAGCTGTTATAAAGGAGAAAAGG - Intronic
1100579021 12:95921189-95921211 CAAATGTTATAAAGAAAAACAGG - Intronic
1100910043 12:99349563-99349585 AAGTTGTTATAAAAGAAAAAGGG + Intronic
1109750148 13:66681265-66681287 CAGTTGTTTAAAATGAAAACTGG - Intronic
1109820963 13:67653659-67653681 AAGTTATTAAAAAGGACAAAAGG - Intergenic
1110793523 13:79611826-79611848 AAGTTGTTATAAAGTTCAATTGG + Intergenic
1112695674 13:101945436-101945458 CAGTTCATATAAAATACAACAGG - Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1115903158 14:38176819-38176841 CAGCTGTTATAATGGCCTACAGG + Intergenic
1116264499 14:42669906-42669928 CAGTGGTTATAGAGGACAAAGGG + Intergenic
1116936697 14:50747889-50747911 AACTTGGTACAAAGGACAACTGG + Intronic
1118941111 14:70339097-70339119 CATCTGTTACAAAGCACAACAGG + Intronic
1121078523 14:91089072-91089094 CAGTTTTTAGAAGGGGCAACTGG - Intronic
1124381462 15:29171042-29171064 GGGTTGTTATAAAGGAAATCTGG - Intronic
1124630440 15:31333827-31333849 GAGTTGTTCTACAAGACAACTGG - Intronic
1125567670 15:40689490-40689512 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1127194673 15:56570782-56570804 CAGCAGTTAAAAAGGACAAAGGG + Intergenic
1127924481 15:63525369-63525391 GAGTTCTCATAAAGGGCAACAGG - Intronic
1128742487 15:70093541-70093563 CAATTGTTAAAAAGAACAACCGG + Intronic
1129749509 15:78051331-78051353 TAGTTGTTATAAAGATCAAATGG - Intronic
1133482983 16:6189624-6189646 AAGTAGCTATAAAGGACAGCTGG + Intronic
1134859271 16:17546568-17546590 CACTAGTTATAAAGGCCAAAAGG + Intergenic
1134859721 16:17550452-17550474 CACTAGTTATAAAGGCCAAAAGG + Intergenic
1135098991 16:19589717-19589739 TATATTTTATAAAGGACAACAGG - Intronic
1138709592 16:58955098-58955120 CAGTTTGTGGAAAGGACAACAGG + Intergenic
1138767763 16:59624461-59624483 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1141370878 16:83485330-83485352 CAGCTGATATAAAGGGAAACTGG - Intronic
1143802478 17:9395647-9395669 CAGTTGACATAAAGAACAGCAGG - Intronic
1145801486 17:27688758-27688780 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1146384296 17:32355632-32355654 CAGTCCTTACAAAGGACATCTGG - Intronic
1147189203 17:38729237-38729259 AAGTTGAGATAAAGGAGAACTGG - Exonic
1148368217 17:47072599-47072621 CAGTAGTTAAAAAGTACGACTGG - Intergenic
1150658599 17:67056591-67056613 CAATGTTCATAAAGGACAACTGG - Exonic
1150732143 17:67704951-67704973 GTGTTGCTATAAAGGACTACTGG + Intergenic
1155109681 18:22701976-22701998 CAGTTGATATAAAGCAGAAATGG + Intergenic
1156914772 18:42452794-42452816 TAGATGTAATAAAGGAAAACTGG + Intergenic
1157190917 18:45580970-45580992 CAGTTGTTCTGCAGGACAGCTGG + Intronic
1164330242 19:24247504-24247526 CATTTGTTTTAAAGGATAAAGGG - Intergenic
1164378292 19:27709205-27709227 CAGTTACTATAAAAGAAAACAGG - Intergenic
1167479870 19:49723405-49723427 TAGTTGAGATAAAGGAGAACAGG - Intergenic
925799846 2:7587561-7587583 AAGTTGTTAGAAATGACAGCTGG + Intergenic
928144412 2:28759213-28759235 CAGTTGTGTAAAAGTACAACAGG + Intronic
928467601 2:31537300-31537322 GAGTTGCTATAAAGGAAAGCAGG - Intronic
930644211 2:53886975-53886997 CAGTGGTTATAAAGGATGAGGGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
935142337 2:100364396-100364418 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
935209678 2:100928402-100928424 CAGCTGTTAAATAGGACAGCTGG + Intronic
946537330 2:220646051-220646073 CAGTTTTTATGAAATACAACAGG - Intergenic
1169016454 20:2296714-2296736 CAGGGGTTACAAAGAACAACAGG + Intronic
1169855443 20:10096995-10097017 CAATTTTTATAATGGACAAATGG + Intergenic
1174451321 20:50622488-50622510 CAGTTATTATAGGGGACTACTGG + Intronic
1175546413 20:59780857-59780879 AAGTTCTTATGAAGGTCAACAGG + Intronic
1178999579 21:37444254-37444276 CACTAGTTATAAAGTACTACAGG - Intronic
950946038 3:16947343-16947365 CAGTTGTGAGATTGGACAACAGG + Intronic
951200191 3:19868007-19868029 CAGTTGTATAAGAGGACAACAGG - Intergenic
951287166 3:20827087-20827109 CATTTGTTATAGAAGTCAACAGG + Intergenic
951673846 3:25215093-25215115 CAGTTGGGATTAAGAACAACTGG - Intronic
952541934 3:34375957-34375979 AAGTGGCTATAAAGGTCAACTGG + Intergenic
953244362 3:41177281-41177303 CAGTTGGAAGAAACGACAACAGG - Intergenic
954568646 3:51622074-51622096 TAGTTCTTTTAAAGGAAAACAGG + Intronic
955472016 3:59295785-59295807 CAGGTGTTTTTCAGGACAACAGG - Intergenic
957195477 3:77061889-77061911 CAGTGGTTATAAAGCAGACCTGG + Intronic
959233245 3:103684933-103684955 CAATTGTTGAAAAGGAGAACAGG + Intergenic
961922838 3:130446006-130446028 CATTTGTTTTAAAGGAGAAATGG + Intronic
961923186 3:130449245-130449267 CAGTTACTATAAAAGAAAACAGG - Intronic
963303937 3:143629045-143629067 CAGATGTTACAGAGGAAAACAGG - Intronic
964939158 3:162133583-162133605 CAGCTGCTATAATGGAGAACAGG - Intergenic
965237810 3:166149222-166149244 CAGTTGATATAAAGGCTAAAGGG - Intergenic
965244772 3:166253481-166253503 AAGTTGTTATAATGGAGAAAAGG - Intergenic
967117680 3:186356497-186356519 CAGTTGATATTAAGCTCAACAGG + Intronic
969008895 4:4044635-4044657 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
973101931 4:46283050-46283072 AAGTTGTTATAAAGGCCATAAGG - Intronic
973855322 4:55005307-55005329 CATTTGGAATAAAGGAAAACAGG + Intergenic
975381427 4:73704852-73704874 CCTTAGCTATAAAGGACAACAGG + Intergenic
975955049 4:79826904-79826926 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
977109603 4:92936625-92936647 CAGACCTTATAAATGACAACAGG - Intronic
979302758 4:119106492-119106514 CAGTTGTCACCAAGGACAACTGG + Intergenic
979486392 4:121275526-121275548 AACTTGCTATAAAGGACCACAGG + Intergenic
980978751 4:139635909-139635931 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
982423962 4:155234924-155234946 GAGTTGTTTTACAGGACACCAGG - Intergenic
983276007 4:165618513-165618535 CAATTGTTCTTAAGGACATCTGG - Intergenic
985765601 5:1777828-1777850 CAGTTGTAACAAAGTACCACGGG - Intergenic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
989318336 5:40107005-40107027 CAGTTACTATAAAAGAAAACAGG + Intergenic
989318674 5:40110238-40110260 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
989352620 5:40503663-40503685 CAGTGGTTATAAAGGGCAACAGG + Intergenic
992340153 5:75814898-75814920 GAGTTGTTACAAAGTTCAACTGG + Intergenic
994378884 5:99046735-99046757 AAGATCTTCTAAAGGACAACTGG - Intergenic
996736378 5:126762515-126762537 AATTTCTTATAAATGACAACAGG + Intergenic
998302410 5:141036777-141036799 CAAATGTTATAAAGGAGAAGGGG - Intergenic
1000224869 5:159250778-159250800 CAGTTGTTACAGAGGAAATCTGG + Intergenic
1004341870 6:14814976-14814998 CAGTAGTGATGAAGGAAAACAGG + Intergenic
1005483275 6:26274801-26274823 CAATTGTAATAAAAGAAAACTGG + Intergenic
1009812061 6:68680921-68680943 GTGTTGTTATAAAGGAATACTGG + Intronic
1010492150 6:76489349-76489371 CATTTGTTTTAAAGGAAAAAGGG + Intergenic
1013144197 6:107371489-107371511 CAGTTGAAATAAATGAAAACAGG - Intronic
1015007893 6:128306401-128306423 CAGATGTTATAAAACAGAACTGG + Intronic
1021218283 7:17943469-17943491 CAGTTGTTACAGAGGAAACCTGG + Intergenic
1021969668 7:25953079-25953101 CCGTTCTTACAAAGGATAACCGG - Intergenic
1022194775 7:28054336-28054358 CAGTTGTTATAAAGGACAACTGG - Intronic
1024553274 7:50581492-50581514 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1025083850 7:56006814-56006836 CAGCTGTTAAAGAGGACAGCAGG + Intergenic
1027471546 7:78580341-78580363 CAGTTCTTGAAAAGGACAATAGG + Intronic
1028537241 7:91903383-91903405 TAGCTGTTATAAAGGAGAAAAGG - Intergenic
1029316071 7:99715517-99715539 TAGTGGTTATATACGACAACAGG + Intronic
1031165890 7:118226176-118226198 CACTTGTTATAAAGCTAAACTGG - Intronic
1031662122 7:124438332-124438354 CAGTATTTACAATGGACAACTGG - Intergenic
1036250166 8:7155300-7155322 CATTTGTTGTAAAGGAGAAAGGG + Intergenic
1036367322 8:8132150-8132172 CATTTGTTGTAAAGGAGAAAGGG - Intergenic
1036883560 8:12533512-12533534 CATTTGTTGTAAAGGAGAAAGGG + Intergenic
1038357600 8:26844090-26844112 CAGATTTTATAAAGGTCATCTGG + Intronic
1039377041 8:37045028-37045050 CTGTTGCTATAAAGGAATACTGG + Intergenic
1041005555 8:53494218-53494240 CAGGTGTTAGAAAGGATAAATGG + Intergenic
1041657993 8:60373587-60373609 CAGTTAACATAAAGGAAAACAGG - Intergenic
1045496652 8:102714988-102715010 CAGATGTTATGAAGGACTAGGGG - Intergenic
1050244191 9:3670622-3670644 CAGTTGTTATTAGGCATAACAGG + Intergenic
1056301196 9:85243799-85243821 CAGCTGCCAAAAAGGACAACGGG + Intergenic
1058579437 9:106439203-106439225 CAGATGTCATCAAGGACAATAGG + Intergenic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1186358114 X:8808634-8808656 ATGTTATTATAAAGGACAACAGG + Intergenic
1188051972 X:25498771-25498793 ACATTGTTATAAAGGACATCTGG - Intergenic
1188990263 X:36810087-36810109 CTGTTATTAAAAAGGACAACAGG - Intergenic
1189258585 X:39660106-39660128 CAGATATCATAAAGGACAAAGGG - Intergenic
1189509322 X:41646159-41646181 CATTTGTTTTAAAGGAGAAAGGG - Intronic
1189557836 X:42163853-42163875 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1189941734 X:46130660-46130682 TAGTTGCTATAATGGGCAACTGG - Intergenic
1190915201 X:54806916-54806938 CAGTTGTGATGAAGGAAAAATGG + Intergenic
1191125293 X:56947686-56947708 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1193212454 X:78823164-78823186 CACTTGTTTTAAAGGATACCTGG + Intergenic
1193691762 X:84654531-84654553 CACTTGTATTAAAGGAAAACAGG - Intergenic
1195472493 X:105246786-105246808 CATCAGTTATATAGGACAACTGG + Intronic
1202246984 Y:22830084-22830106 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202399973 Y:24463832-24463854 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202470808 Y:25206254-25206276 CATTTGTTTTAAAGGAGAAAGGG - Intergenic