ID: 1022195238

View in Genome Browser
Species Human (GRCh38)
Location 7:28059185-28059207
Sequence TTAATTTACCAGGTTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022195233_1022195238 29 Left 1022195233 7:28059133-28059155 CCTGCTAGGACCTTCTTTGTAAT 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1022195238 7:28059185-28059207 TTAATTTACCAGGTTTCTTTTGG No data
1022195234_1022195238 19 Left 1022195234 7:28059143-28059165 CCTTCTTTGTAATTAATAATATT 0: 1
1: 1
2: 3
3: 81
4: 989
Right 1022195238 7:28059185-28059207 TTAATTTACCAGGTTTCTTTTGG No data
1022195235_1022195238 -8 Left 1022195235 7:28059170-28059192 CCTTCAATTCCATTATTAATTTA 0: 1
1: 0
2: 1
3: 46
4: 632
Right 1022195238 7:28059185-28059207 TTAATTTACCAGGTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022195238 Original CRISPR TTAATTTACCAGGTTTCTTT TGG Intronic
No off target data available for this crispr